9-92474742-C-CTCATCATCATCATCATCATCATCA

Variant names:

• chr9-92474742-C-CTCATCATCATCATCATCATCATCA
• rs3078372
• ENST00000375544.7:c.132_155dupTGATGATGATGATGATGATGATGA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The ENST00000375544.7(ASPN):​c.132_155dupTGATGATGATGATGATGATGATGA​(p.Asp44_Asp51dup) variant causes a disruptive inframe insertion change. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: ASPN ENST00000375544.7 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.52
• Publications: 0 publications found

Genes affected

ASPN (HGNC:14872): (asporin) This gene encodes a cartilage extracellular protein that is member of the small leucine-rich proteoglycan family. The encoded protein may regulate chondrogenesis by inhibiting transforming growth factor-beta 1-induced gene expression in cartilage. This protein also binds collagen and calcium and may induce collagen mineralization. Polymorphisms in the aspartic acid repeat region of this gene are associated with a susceptibility to osteoarthritis, and also with intervertebral disc disease. Alternative splicing of this gene results in multiple transcript variants.[provided by RefSeq, Jul 2014]

CENPP (HGNC:32933): (centromere protein P) CENPP is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]).[supplied by OMIM, Mar 2008]

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in ENST00000375544.7

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CENPP	NM_001012267.3	c.564+94904_564+94927dupATCATCATCATCATCATCATCATC		intron_variant	Intron 5 of 7	ENST00000375587.8	NP_001012267.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ASPN	ENST00000375544.7	c.132_155dupTGATGATGATGATGATGATGATGA	p.Asp44_Asp51dup	disruptive_inframe_insertion	Exon 2 of 8	1		ENSP00000364694.3
CENPP	ENST00000375587.8	c.564+94904_564+94927dupATCATCATCATCATCATCATCATC		intron_variant	Intron 5 of 7	1	NM_001012267.3	ENSP00000364737.3

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome AF: 0.00000144 AC: 2 AN: 1387046 Hom.: 0 Cov.: 0 AF XY: 0.00000290 AC XY: 2 AN XY: 690652

African (AFR) AF: 0.00 AC: 0 AN: 30720

American (AMR) AF: 0.00 AC: 0 AN: 41068

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24902

East Asian (EAS) AF: 0.00 AC: 0 AN: 37702

South Asian (SAS) AF: 0.0000122 AC: 1 AN: 81708

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 50526

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5576

European-Non Finnish (NFE) AF: 9.46e-7 AC: 1 AN: 1057302

Other (OTH) AF: 0.00 AC: 0 AN: 57542

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3078372; hg19: chr9-95237024;