9-92474742-CTCATCATCATCATCATCATCATCA-CTCATCATCATCATCATCATCATCATCATCATCATCATCATCATCA

Variant names:

• chr9-92474765-C-CATCATCATCATCATCATCATC
• NM_017680.6:c.112_132dupGATGATGATGATGATGATGAT

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_017680.6(ASPN):​c.112_132dupGATGATGATGATGATGATGAT​(p.Asp44_Asp45insAspAspAspAspAspAspAsp) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. D44D) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 31)
• Consequence: ASPN NM_017680.6 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.438
• Publications: 0 publications found

Genes affected

ASPN (HGNC:14872): (asporin) This gene encodes a cartilage extracellular protein that is member of the small leucine-rich proteoglycan family. The encoded protein may regulate chondrogenesis by inhibiting transforming growth factor-beta 1-induced gene expression in cartilage. This protein also binds collagen and calcium and may induce collagen mineralization. Polymorphisms in the aspartic acid repeat region of this gene are associated with a susceptibility to osteoarthritis, and also with intervertebral disc disease. Alternative splicing of this gene results in multiple transcript variants.[provided by RefSeq, Jul 2014]

CENPP (HGNC:32933): (centromere protein P) CENPP is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]).[supplied by OMIM, Mar 2008]

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_017680.6

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_017680.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ASPN	NM_017680.6	MANE Select	c.112_132dupGATGATGATGATGATGATGAT	p.Asp44_Asp45insAspAspAspAspAspAspAsp	conservative_inframe_insertion	Exon 2 of 8	NP_060150.4
	CENPP	NM_001012267.3	MANE Select	c.564+94907_564+94927dupATCATCATCATCATCATCATC		intron	N/A	NP_001012267.1	Q6IPU0-1
	ASPN	NM_001193335.3		c.112_132dupGATGATGATGATGATGATGAT	p.Asp44_Asp45insAspAspAspAspAspAspAsp	conservative_inframe_insertion	Exon 2 of 6	NP_001180264.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ASPN	ENST00000375544.7	TSL:1	c.112_132dupGATGATGATGATGATGATGAT	p.Asp44_Asp45insAspAspAspAspAspAspAsp	conservative_inframe_insertion	Exon 2 of 8	ENSP00000364694.3	Q9BXN1
	CENPP	ENST00000375587.8	TSL:1 MANE Select	c.564+94907_564+94927dupATCATCATCATCATCATCATC		intron	N/A	ENSP00000364737.3	Q6IPU0-1
	ASPN	ENST00000907468.1		c.112_132dupGATGATGATGATGATGATGAT	p.Asp44_Asp45insAspAspAspAspAspAspAsp	conservative_inframe_insertion	Exon 3 of 9	ENSP00000577527.1

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 40

GnomAD4 genome Cov.: 31

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.44

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

hg19: chr9-95237047;