ENST00000602385.3:n.378_*747del

Variant names:

• chr3-169764385-CAACAAAAAGCGGAAGACGGGAGAACCCACGCAGGAACGGCTCCAGGCAACCCCGGCTCACTGCCCATTCATTTTGGCCGACTTTGGAGGTGCCTTCACGTCTCCTGCCAATTTGCAGCACACTGGCCCAGTCAGTCAGGTTTGGGGGTTCACAAGCCCCCATTGCCGGCGAGGGGTGACGGATGCGCACGATCGGCGTTCCCCCCACCAACAGGAAAGCGAACTGCATGTGTGAGCCGAGTCCTGGGTGCACGTCCCACAGCTCAGGGAATCGCGCCGCGCGCGGGGACTCGCTCCGT-C
• ENST00000602385.3:n.378_*224del

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000602385.3(TERC):​n.378_*224del variant causes a splice region, non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TERC ENST00000602385.3 splice_region, non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.684
• Publications: 0 publications found

Genes affected

TERC (HGNC:11727): (telomerase RNA component) Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, and an RNA component, encoded by this gene, that serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Mutations in this gene cause autosomal dominant dyskeratosis congenita, and may also be associated with some cases of aplastic anemia. [provided by RefSeq, Jul 2008]

TERC Gene-Disease associations (from GenCC):

• dyskeratosis congenita, autosomal dominant 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen, PanelApp Australia, G2P, Ambry Genetics
• acute myeloid leukemia

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp

ENSG00000296372 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000602385.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TERC	NR_001566.3	MANE Select	n.378_*224del		splice_region non_coding_transcript_exon	Exon 1 of 1
	TERC	NR_001566.3	MANE Select	n.378_*224del		downstream_gene	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TERC	ENST00000602385.3	TSL:6 MANE Select	n.378_*224del		splice_region non_coding_transcript_exon	Exon 1 of 1
	ENSG00000296372	ENST00000738610.1		n.1_298del		non_coding_transcript_exon	Exon 1 of 1
	TERC	ENST00000602385.3	TSL:6 MANE Select	n.378_*224del		downstream_gene	N/A

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.68

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr3-169482173;