ENST00000706918.1:c.190_213delGCAGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2BP3
The ENST00000706918.1(POLGARF):c.190_213delGCAGCAGCAGCAGCAGCAGCAGCA(p.Ala64_Ala71del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000939 in 1,598,000 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. A64A) has been classified as Uncertain significance.
Frequency
Consequence
ENST00000706918.1 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 1 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
POLG | NM_002693.3 | c.135_158delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln46_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | ENST00000268124.11 | NP_002684.1 | |
POLGARF | NM_001430120.1 | c.190_213delGCAGCAGCAGCAGCAGCAGCAGCA | p.Ala64_Ala71del | conservative_inframe_deletion | Exon 1 of 2 | NP_001417049.1 | ||
POLG | NM_001126131.2 | c.135_158delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln46_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | NP_001119603.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
POLGARF | ENST00000706918.1 | c.190_213delGCAGCAGCAGCAGCAGCAGCAGCA | p.Ala64_Ala71del | conservative_inframe_deletion | Exon 1 of 2 | ENSP00000516626.1 | ||||
POLG | ENST00000268124.11 | c.135_158delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln46_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | 1 | NM_002693.3 | ENSP00000268124.5 |
Frequencies
GnomAD3 genomes AF: 0.0000132 AC: 2AN: 151604Hom.: 0 Cov.: 30
GnomAD4 exome AF: 0.00000899 AC: 13AN: 1446396Hom.: 0 AF XY: 0.00000556 AC XY: 4AN XY: 719198
GnomAD4 genome AF: 0.0000132 AC: 2AN: 151604Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0AN XY: 74046
ClinVar
Submissions by phenotype
not provided Uncertain:1
- -
Progressive sclerosing poliodystrophy Uncertain:1
This variant, c.135_158del, results in the deletion of 8 amino acid(s) of the POLG protein (p.Gln48_Gln55del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POLG-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at