ENST00000706918.1:c.193_213dupGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr15-89333596-T-TTGCTGCTGCTGCTGCTGCTGC
• rs41550117
• NM_001430120.1:c.193_213dupGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 2P and 2B. PM1 BP3 BP6

The ENST00000706918.1(POLGARF):​c.193_213dupGCAGCAGCAGCAGCAGCAGCA​(p.Ala65_Ala71dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000594 in 151,604 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. A71A) has been classified as Uncertain significance.

• Frequency:
  • Genomes: 𝑓 0.000059 (0 hom., cov: 30)
  • Exomes 𝑓: 0.000014 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: POLGARF ENST00000706918.1 conservative_inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:1
• Conservation: PhyloP100: -2.20
• Publications: 13 publications found

Genes affected

POLGARF (HGNC:56246): (POLG alternative reading frame) This gene uses the same transcript as the POLG gene but has a CUG start codon and an alternate reading frame that makes a 260 aa protein. This protein is distinct from POLG isoforms and may interact with P32 (also known as C1QBP), a mitochondrial matrix protein thought to be involved in the expression of mitochondrial genome-encoded proteins. POLGARF protein may bind P32 and sequester it in the nucleolus. Interestingly, some disease-causing mutations thought to be in POLG may instead be associated with POLGARF. [provided by RefSeq, May 2022]

POLG (HGNC:9179): (DNA polymerase gamma, catalytic subunit) Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

POLG Gene-Disease associations (from GenCC):

• progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• mitochondrial DNA depletion syndrome 4a

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Ambry Genetics
• sensory ataxic neuropathy, dysarthria, and ophthalmoparesis

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, G2P
• autosomal dominant progressive external ophthalmoplegia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive progressive external ophthalmoplegia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mitochondrial neurogastrointestinal encephalomyopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• recessive mitochondrial ataxia syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• spinocerebellar ataxia with epilepsy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Leigh syndrome

  Inheritance: AR Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

• PM1: In a hotspot region, there are 6 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 12 benign, 11 uncertain in ENST00000706918.1
• BP3: Nonframeshift variant in repetitive region in ENST00000706918.1
• BP6: Variant 15-89333596-T-TTGCTGCTGCTGCTGCTGCTGC is Benign according to our data. Variant chr15-89333596-T-TTGCTGCTGCTGCTGCTGCTGC is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 1025609.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000706918.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POLGARF	NM_001430120.1	MANE Select	c.193_213dupGCAGCAGCAGCAGCAGCAGCA	p.Ala65_Ala71dup	conservative_inframe_insertion	Exon 1 of 2	NP_001417049.1	A0A3B3IS91
	POLG	NM_002693.3	MANE Select	c.138_158dupGCAGCAGCAGCAGCAGCAGCA	p.Gln47_Gln53dup	disruptive_inframe_insertion	Exon 2 of 23	NP_002684.1	P54098
	POLG	NM_001126131.2		c.138_158dupGCAGCAGCAGCAGCAGCAGCA	p.Gln47_Gln53dup	disruptive_inframe_insertion	Exon 2 of 23	NP_001119603.1	P54098

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POLGARF	ENST00000706918.1	MANE Select	c.193_213dupGCAGCAGCAGCAGCAGCAGCA	p.Ala65_Ala71dup	conservative_inframe_insertion	Exon 1 of 2	ENSP00000516626.1	A0A3B3IS91
	POLG	ENST00000268124.11	TSL:1 MANE Select	c.138_158dupGCAGCAGCAGCAGCAGCAGCA	p.Gln47_Gln53dup	disruptive_inframe_insertion	Exon 2 of 23	ENSP00000268124.5	P54098
	POLG	ENST00000442287.6	TSL:1	c.138_158dupGCAGCAGCAGCAGCAGCAGCA	p.Gln47_Gln53dup	disruptive_inframe_insertion	Exon 2 of 23	ENSP00000399851.2	P54098

Frequencies

GnomAD3 genomes AF: 0.0000594 AC: 9 AN: 151604 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000393

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000442

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000138 AC: 20 AN: 1446392 Hom.: 0 Cov.: 31 AF XY: 0.00000556 AC XY: 4 AN XY: 719196

African (AFR) AF: 0.00 AC: 0 AN: 32852

American (AMR) AF: 0.0000228 AC: 1 AN: 43886

Ashkenazi Jewish (ASJ) AF: 0.0000387 AC: 1 AN: 25858

East Asian (EAS) AF: 0.00 AC: 0 AN: 39412

South Asian (SAS) AF: 0.00 AC: 0 AN: 85292

European-Finnish (FIN) AF: 0.0000208 AC: 1 AN: 48040

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5694

European-Non Finnish (NFE) AF: 0.0000118 AC: 13 AN: 1105656

Other (OTH) AF: 0.0000670 AC: 4 AN: 59702

GnomAD4 genome AF: 0.0000594 AC: 9 AN: 151604 Hom.: 0 Cov.: 30 AF XY: 0.0000540 AC XY: 4 AN XY: 74046

African (AFR) AF: 0.00 AC: 0 AN: 41194

American (AMR) AF: 0.000393 AC: 6 AN: 15256

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5176

South Asian (SAS) AF: 0.00 AC: 0 AN: 4804

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10558

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000442 AC: 3 AN: 67852

Other (OTH) AF: 0.00 AC: 0 AN: 2076

Alfa AF: 0.00 Hom.: 29

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	-	1	Inborn genetic diseases (1)
-	1	-	Progressive sclerosing poliodystrophy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-2.2
Mutation Taster		=86/14	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs41550117; hg19: chr15-89876827;