X-101346569-T-TGGCTTGTATCAATGAAGCGCTCAACGCAGTTCACAAAACAGGCCTCAGCCCGACTGTCCAACTTTGGCCCA

Variant names:

• chrX-101346569-T-TGGCTTGTATCAATGAAGCGCTCAACGCAGTTCACAAAACAGGCCTCAGCCCGACTGTCCAACTTTGGCCCA
• NM_004085.4:c.153_223dupTGGGCCAAAGTTGGACAGTCGGGCTGAGGCCTGTTTTGTGAACTGCGTTGAGCGCTTCATTGATACAAGCC

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_004085.4(TIMM8A):​c.153_223dupTGGGCCAAAGTTGGACAGTCGGGCTGAGGCCTGTTTTGTGAACTGCGTTGAGCGCTTCATTGATACAAGCC​(p.Gln75LeufsTer14) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 23)
• Consequence: TIMM8A NM_004085.4 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.79

Genes affected

TIMM8A (HGNC:11817): (translocase of inner mitochondrial membrane 8A) This translocase is involved in the import and insertion of hydrophobic membrane proteins from the cytoplasm into the mitochondrial inner membrane. The gene is mutated in Mohr-Tranebjaerg syndrome/Deafness Dystonia Syndrome (MTS/DDS) and it is postulated that MTS/DDS is a mitochondrial disease caused by a defective mitochondrial protein import system. Defects in this gene also cause Jensen syndrome; an X-linked disease with opticoacoustic nerve atrophy and muscle weakness. This protein, along with TIMM13, forms a 70 kDa heterohexamer. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Mar 2009]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.241 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-101346569-T-TGGCTTGTATCAATGAAGCGCTCAACGCAGTTCACAAAACAGGCCTCAGCCCGACTGTCCAACTTTGGCCCA is Pathogenic according to our data. Variant chrX-101346569-T-TGGCTTGTATCAATGAAGCGCTCAACGCAGTTCACAAAACAGGCCTCAGCCCGACTGTCCAACTTTGGCCCA is described in ClinVar as [Pathogenic]. Clinvar id is 3601880.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TIMM8A	NM_004085.4	c.153_223dupTGGGCCAAAGTTGGACAGTCGGGCTGAGGCCTGTTTTGTGAACTGCGTTGAGCGCTTCATTGATACAAGCC	p.Gln75LeufsTer14	frameshift_variant, stop_gained	Exon 2 of 2	ENST00000372902.4	NP_004076.1
TIMM8A	NM_001145951.2	c.*1747_*1817dupTGGGCCAAAGTTGGACAGTCGGGCTGAGGCCTGTTTTGTGAACTGCGTTGAGCGCTTCATTGATACAAGCC		3_prime_UTR_variant	Exon 2 of 2		NP_001139423.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TIMM8A	ENST00000372902.4	c.153_223dupTGGGCCAAAGTTGGACAGTCGGGCTGAGGCCTGTTTTGTGAACTGCGTTGAGCGCTTCATTGATACAAGCC	p.Gln75LeufsTer14	frameshift_variant, stop_gained	Exon 2 of 2	1	NM_004085.4	ENSP00000361993.3

Frequencies

GnomAD3 genomes Cov.: 23

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 23

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Deafness dystonia syndrome Pathogenic:1

Jan 09, 2025

Institute of Rare Diseases, West China Hospital, Sichuan University

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

PVS1;PM3_Supporting;PM2_Supporting -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-100601557;