X-148500637-TGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCC-TGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCC

Variant names:

• chrX-148500637-T-TGCCGCCGCCGCCGCCGCCGCCGCC
• rs193922937
• NM_002025.4:c.-437_-414dupCGCCGCCGCCGCCGCCGCCGCCGC

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The NM_002025.4(AFF2):​c.-437_-414dupCGCCGCCGCCGCCGCCGCCGCCGC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.012 (36 hom., 122 hem., cov: 0)
• Consequence: AFF2 NM_002025.4 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.80
• Publications: 1 publications found

Genes affected

AFF2 (HGNC:3776): (ALF transcription elongation factor 2) This gene encodes a putative transcriptional activator that is a member of the AF4\FMR2 gene family. This gene is associated with the folate-sensitive fragile X E locus on chromosome X. A repeat polymorphism in the fragile X E locus results in silencing of this gene causing Fragile X E syndrome. Fragile X E syndrome is a form of nonsyndromic X-linked cognitive disability. In addition, this gene contains 6-25 GCC repeats that are expanded to >200 repeats in the disease state. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jul 2016]

AFF2 Gene-Disease associations (from GenCC):

• FRAXE intellectual disability

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae)
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen

ENSG00000237741 (HGNC:):

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population amr. GnomAd4 allele frequency = 0.0122 (890/73125) while in subpopulation AMR AF = 0.0135 (90/6670). AF 95% confidence interval is 0.0112. There are 36 homozygotes in GnomAd4. There are 122 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 36 XL gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002025.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AFF2	NM_002025.4	MANE Select	c.-437_-414dupCGCCGCCGCCGCCGCCGCCGCCGC		5_prime_UTR	Exon 1 of 21	NP_002016.2
	AFF2	NM_001169123.2		c.-437_-414dupCGCCGCCGCCGCCGCCGCCGCCGC		5_prime_UTR	Exon 1 of 21	NP_001162594.1
	AFF2	NM_001169122.2		c.-437_-414dupCGCCGCCGCCGCCGCCGCCGCCGC		5_prime_UTR	Exon 1 of 20	NP_001162593.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AFF2	ENST00000370460.7	TSL:5 MANE Select	c.-437_-414dupCGCCGCCGCCGCCGCCGCCGCCGC		5_prime_UTR	Exon 1 of 21	ENSP00000359489.2
	AFF2	ENST00000342251.7	TSL:1	c.-461_-460insGCCGCCGCCGCCGCCGCCGCCGCC		upstream_gene	N/A	ENSP00000345459.4
	ENSG00000237741	ENST00000456981.1	TSL:3	n.-46_-23dupGGCGGCGGCGGCGGCGGCGGCGGC		upstream_gene	N/A

Frequencies

GnomAD3 genomes AF: 0.0122 AC: 891 AN: 73140 Hom.: 36 Cov.: 0

Gnomad AFR AF: 0.0119

Gnomad AMI AF: 0.00246

Gnomad AMR AF: 0.0135

Gnomad ASJ AF: 0.0300

Gnomad EAS AF: 0.00898

Gnomad SAS AF: 0.00936

Gnomad FIN AF: 0.00104

Gnomad MID AF: 0.00980

Gnomad NFE AF: 0.0121

Gnomad OTH AF: 0.0137

GnomAD4 exome Cov.: 0

GnomAD4 genome AF: 0.0122 AC: 890 AN: 73125 Hom.: 36 Cov.: 0 AF XY: 0.00789 AC XY: 122 AN XY: 15467

African (AFR) AF: 0.0119 AC: 235 AN: 19703

American (AMR) AF: 0.0135 AC: 90 AN: 6670

Ashkenazi Jewish (ASJ) AF: 0.0300 AC: 60 AN: 1999

East Asian (EAS) AF: 0.00903 AC: 18 AN: 1994

South Asian (SAS) AF: 0.00948 AC: 13 AN: 1372

European-Finnish (FIN) AF: 0.00104 AC: 2 AN: 1921

Middle Eastern (MID) AF: 0.0109 AC: 1 AN: 92

European-Non Finnish (NFE) AF: 0.0120 AC: 457 AN: 38015

Other (OTH) AF: 0.0136 AC: 13 AN: 953

Alfa AF: 0.00 Hom.: 154

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922937; hg19: chrX-147582157;