X-154030622-GGGGCTGGTGGGGTCCTCGGAGCTCTC-G
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_001110792.2(MECP2):c.1216_1241delGAGAGCTCCGAGGACCCCACCAGCCC(p.Glu406ProfsTer2) variant causes a frameshift change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. E406E) has been classified as Likely benign.
Frequency
Consequence
NM_001110792.2 frameshift
Scores
Clinical Significance
Conservation
Publications
- chromosome Xq28 duplication syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- Rett syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
- severe neonatal-onset encephalopathy with microcephalyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- syndromic X-linked intellectual disability Lubs typeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- atypical Rett syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked intellectual disability-psychosis-macroorchidism syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- systemic lupus erythematosusInheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MECP2 | NM_001110792.2 | MANE Select | c.1216_1241delGAGAGCTCCGAGGACCCCACCAGCCC | p.Glu406ProfsTer2 | frameshift | Exon 3 of 3 | NP_001104262.1 | ||
| MECP2 | NM_004992.4 | MANE Plus Clinical | c.1180_1205delGAGAGCTCCGAGGACCCCACCAGCCC | p.Glu394ProfsTer2 | frameshift | Exon 4 of 4 | NP_004983.1 | ||
| MECP2 | NM_001316337.2 | c.901_926delGAGAGCTCCGAGGACCCCACCAGCCC | p.Glu301ProfsTer2 | frameshift | Exon 5 of 5 | NP_001303266.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MECP2 | ENST00000453960.7 | TSL:1 MANE Select | c.1216_1241delGAGAGCTCCGAGGACCCCACCAGCCC | p.Glu406ProfsTer2 | frameshift | Exon 3 of 3 | ENSP00000395535.2 | ||
| MECP2 | ENST00000303391.11 | TSL:1 MANE Plus Clinical | c.1180_1205delGAGAGCTCCGAGGACCCCACCAGCCC | p.Glu394ProfsTer2 | frameshift | Exon 4 of 4 | ENSP00000301948.6 | ||
| MECP2 | ENST00000630151.3 | TSL:5 | c.1180_1205delGAGAGCTCCGAGGACCCCACCAGCCC | p.Glu394ProfsTer2 | frameshift | Exon 4 of 4 | ENSP00000486089.2 |
Frequencies
GnomAD3 genomes Cov.: 17
GnomAD4 genome Cov.: 17
ClinVar
Submissions by phenotype
Rett syndrome Pathogenic:2
Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as Pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). This variant has been identified as a de novo occurrence in an individual with Rett syndrome without confirmation of paternity and maternity (PM6) PMID: 23696494. This variant is absent from gnomAD (PM2_Supporting).
not provided Other:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at