X-154030698-TTTGGGGACTCTGAGTGGTGGTGATGGTGGTGGTGCTCCTTC-T
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001110792.2(MECP2):c.1125_1165delGAAGGAGCACCACCACCATCACCACCACTCAGAGTCCCCAA(p.Lys376GlyfsTer15) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. K375K) has been classified as Likely benign.
Frequency
Consequence
NM_001110792.2 frameshift
Scores
Clinical Significance
Conservation
Publications
- chromosome Xq28 duplication syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- Rett syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
- severe neonatal-onset encephalopathy with microcephalyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- syndromic X-linked intellectual disability Lubs typeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- atypical Rett syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked intellectual disability-psychosis-macroorchidism syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- systemic lupus erythematosusInheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| MECP2 | NM_001110792.2 | c.1125_1165delGAAGGAGCACCACCACCATCACCACCACTCAGAGTCCCCAA | p.Lys376GlyfsTer15 | frameshift_variant | Exon 3 of 3 | ENST00000453960.7 | NP_001104262.1 | |
| MECP2 | NM_004992.4 | c.1089_1129delGAAGGAGCACCACCACCATCACCACCACTCAGAGTCCCCAA | p.Lys364GlyfsTer15 | frameshift_variant | Exon 4 of 4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MECP2 | ENST00000453960.7 | c.1125_1165delGAAGGAGCACCACCACCATCACCACCACTCAGAGTCCCCAA | p.Lys376GlyfsTer15 | frameshift_variant | Exon 3 of 3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
| MECP2 | ENST00000303391.11 | c.1089_1129delGAAGGAGCACCACCACCATCACCACCACTCAGAGTCCCCAA | p.Lys364GlyfsTer15 | frameshift_variant | Exon 4 of 4 | 1 | NM_004992.4 | ENSP00000301948.6 |
Frequencies
GnomAD3 genomes Cov.: 21
GnomAD4 genome Cov.: 21
ClinVar
Submissions by phenotype
Rett syndrome Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at