X-48902316-AGGGGCCACGACAAGTCAGACC-A
Variant summary
Our verdict is Benign. Variant got -7 ACMG points: 2P and 9B. PM4BP6BS1BS2
The NM_001032382.2(PQBP1):c.393_413delAGACCGGGGCCACGACAAGTC(p.Asp132_Ser138del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00011 in 1,209,274 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 31 hemizygotes in GnomAD. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_001032382.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Benign. Variant got -7 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PQBP1 | NM_001032382.2 | c.393_413delAGACCGGGGCCACGACAAGTC | p.Asp132_Ser138del | disruptive_inframe_deletion | Exon 5 of 7 | ENST00000447146.7 | NP_001027554.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000297 AC: 33AN: 111185Hom.: 0 Cov.: 22 AF XY: 0.000179 AC XY: 6AN XY: 33441
GnomAD3 exomes AF: 0.000203 AC: 37AN: 182557Hom.: 0 AF XY: 0.000104 AC XY: 7AN XY: 67145
GnomAD4 exome AF: 0.0000911 AC: 100AN: 1098036Hom.: 0 AF XY: 0.0000688 AC XY: 25AN XY: 363406
GnomAD4 genome AF: 0.000297 AC: 33AN: 111238Hom.: 0 Cov.: 22 AF XY: 0.000179 AC XY: 6AN XY: 33504
ClinVar
Submissions by phenotype
not specified Uncertain:1Benign:1
- -
- -
not provided Benign:2
This variant is associated with the following publications: (PMID: 16493439) -
- -
Inborn genetic diseases Uncertain:1
The c.393_413del21 (p.G134_R140del) alteration is located in exon 5 (coding exon 4) of the PQBP1 gene. This alteration consists of an in-frame deletion of 21 nucleotides between nucleotide positions c.393 and c.413, resulting in the deletion of 7 residues. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -
PQBP1-related disorder Benign:1
This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at