chr11-61835024-C-CCTCCCTGCCTCCCCAGGGACTT

Variant names:

• chr11-61835023-TC-TCCTCCCTGCCTCCCCAGGGACT
• NM_004265.4:c.208-2753_208-2733dupCTCCCTGCCTCCCCAGGGACT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_004265.4(FADS2):​c.208-2753_208-2733dupCTCCCTGCCTCCCCAGGGACT variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 0)
• Consequence: FADS2 NM_004265.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00
• Publications: 0 publications found

Genes affected

FADS2 (HGNC:3575): (fatty acid desaturase 2) The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004265.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FADS2	NM_004265.4	MANE Select	c.208-2753_208-2733dupCTCCCTGCCTCCCCAGGGACT		intron	N/A	NP_004256.1	O95864-1
	FADS2	NM_001281501.1		c.142-2753_142-2733dupCTCCCTGCCTCCCCAGGGACT		intron	N/A	NP_001268430.1	O95864-2
	FADS2	NM_001281502.1		c.115-2753_115-2733dupCTCCCTGCCTCCCCAGGGACT		intron	N/A	NP_001268431.1	O95864-4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FADS2	ENST00000278840.9	TSL:1 MANE Select	c.208-2754_208-2753insCTCCCTGCCTCCCCAGGGACT		intron	N/A	ENSP00000278840.4	O95864-1
	FADS2	ENST00000257261.10	TSL:1	c.142-2754_142-2753insCTCCCTGCCTCCCCAGGGACT		intron	N/A	ENSP00000257261.6	O95864-2
	FADS2	ENST00000521849.5	TSL:1	c.208-2754_208-2753insCTCCCTGCCTCCCCAGGGACT		intron	N/A	ENSP00000431091.1	O95864-3

Frequencies

GnomAD3 genomes Cov.: 0

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

hg19: chr11-61602495;