chr13-20189474-GA-GAGGATCATAATGCGAAAAATGAAGAGGACG

Variant names:

• chr13-20189472-ACGA-ACGAGGATCATAATGCGAAAAATGAAGAGG
• NM_004004.6:c.81_106dupCCTCTTCATTTTTCGCATTATGATCC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_004004.6(GJB2):​c.81_106dupCCTCTTCATTTTTCGCATTATGATCC​(p.Leu36ProfsTer8) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. L36L) has been classified as Likely benign. The gene GJB2 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 33)
• Consequence: GJB2 NM_004004.6 frameshift, stop_gained
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 5.01
• Publications: 0 publications found

Genes affected

GJB2 (HGNC:4284): (gap junction protein beta 2) This gene encodes a member of the gap junction protein family. The gap junctions were first characterized by electron microscopy as regionally specialized structures on plasma membranes of contacting adherent cells. These structures were shown to consist of cell-to-cell channels that facilitate the transfer of ions and small molecules between cells. The gap junction proteins, also known as connexins, purified from fractions of enriched gap junctions from different tissues differ. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene are responsible for as much as 50% of pre-lingual, recessive deafness. [provided by RefSeq, Oct 2008]

GJB2 Gene-Disease associations (from GenCC):

• Bart-Pumphrey syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• ichthyosis, hystrix-like, with hearing loss

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
• keratoderma hereditarium mutilans

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Genomics England PanelApp
• palmoplantar keratoderma-deafness syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, G2P
• syndromic genetic hearing loss

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• autosomal recessive nonsyndromic hearing loss 1A

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• nonsyndromic genetic hearing loss

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• autosomal dominant keratitis-ichthyosis-hearing loss syndrome

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Genomics England PanelApp
• autosomal dominant nonsyndromic hearing loss 3A

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
• autosomal dominant nonsyndromic hearing loss

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• KID syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hearing loss, autosomal recessive

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000296095 (HGNC:):

ACMG classification

Specifications for GJB2 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 215 pathogenic variants in the truncated region.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004004.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GJB2	NM_004004.6	MANE Select	c.81_106dupCCTCTTCATTTTTCGCATTATGATCC	p.Leu36ProfsTer8	frameshift stop_gained	Exon 2 of 2	NP_003995.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GJB2	ENST00000382848.5	TSL:1 MANE Select	c.81_106dupCCTCTTCATTTTTCGCATTATGATCC	p.Leu36ProfsTer8	frameshift stop_gained	Exon 2 of 2	ENSP00000372299.4	P29033
	GJB2	ENST00000382844.2	TSL:6	c.81_106dupCCTCTTCATTTTTCGCATTATGATCC	p.Leu36ProfsTer8	frameshift stop_gained	Exon 1 of 1	ENSP00000372295.1	P29033
	GJB2	ENST00000906230.1		c.81_106dupCCTCTTCATTTTTCGCATTATGATCC	p.Leu36ProfsTer8	frameshift stop_gained	Exon 2 of 2	ENSP00000576289.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 33

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

hg19: chr13-20763611;