chr17-50194323-GCCAGGCTGAAAGCCTGGGGCCTCACCTTGGCA-G
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_000088.4(COL1A1):c.1608_1614+25delTGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG(p.Ala537fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as no classification for the single variant (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000088.4 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Caffey diseaseInheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Orphanet, Ambry Genetics
- COL1A1-related Ehlers-Danlos syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- combined osteogenesis imperfecta and Ehlers-Danlos syndrome 1Inheritance: AD Classification: DEFINITIVE, MODERATE Submitted by: ClinGen, Ambry Genetics
- Ehlers-Danlos syndromeInheritance: AD Classification: DEFINITIVE Submitted by: G2P
- Ehlers-Danlos syndrome, arthrochalasia typeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, G2P, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
- osteogenesis imperfectaInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- osteogenesis imperfecta type 1Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- osteogenesis imperfecta type 2Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- osteogenesis imperfecta type 3Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
- osteogenesis imperfecta type 4Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, G2P, Orphanet
- Ehlers-Danlos syndrome, classic type, 1Inheritance: AD Classification: MODERATE Submitted by: ClinGen
- Ehlers-Danlos syndrome, classic typeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Ehlers-Danlos/osteogenesis imperfecta syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- high bone mass osteogenesis imperfectaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000088.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL1A1 | TSL:1 MANE Select | c.1608_1614+25delTGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG | p.Ala537fs | frameshift splice_donor splice_region intron | Exon 23 of 51 | ENSP00000225964.6 | P02452 | ||
| COL1A1 | c.1608_1614+25delTGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG | p.Ala537fs | frameshift splice_donor splice_region intron | Exon 23 of 51 | ENSP00000531393.1 | ||||
| COL1A1 | c.1608_1614+25delTGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG | p.Ala537fs | frameshift splice_donor splice_region intron | Exon 23 of 51 | ENSP00000531398.1 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at