chr17-50194323-GCCAGGCTGAAAGCCTGGGGCCTCACCTTGGCA-G

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate

The NM_000088.4(COL1A1):​c.1609_1614+25delGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGG​(p.Ala537_Lys538del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

Frequency

Genomes: not found (cov: 31)

Consequence

COL1A1
NM_000088.4 splice_donor, conservative_inframe_deletion, splice_region, intron

Scores

Not classified

Clinical Significance

Not reported in ClinVar

Conservation

PhyloP100: 0.454

Publications

0 publications found
Variant links:
Genes affected
COL1A1 (HGNC:2197): (collagen type I alpha 1 chain) This gene encodes the pro-alpha1 chains of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIA, Ehlers-Danlos syndrome Classical type, Caffey Disease and idiopathic osteoporosis. Reciprocal translocations between chromosomes 17 and 22, where this gene and the gene for platelet-derived growth factor beta are located, are associated with a particular type of skin tumor called dermatofibrosarcoma protuberans, resulting from unregulated expression of the growth factor. Two transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008]
COL1A1 Gene-Disease associations (from GenCC):
  • Caffey disease
    Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Orphanet, Ambry Genetics
  • COL1A1-related Ehlers-Danlos syndrome
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • combined osteogenesis imperfecta and Ehlers-Danlos syndrome 1
    Inheritance: AD Classification: DEFINITIVE, MODERATE Submitted by: ClinGen, Ambry Genetics
  • Ehlers-Danlos syndrome
    Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
  • Ehlers-Danlos syndrome, arthrochalasia type
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, G2P, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
  • osteogenesis imperfecta
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • osteogenesis imperfecta type 1
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
  • osteogenesis imperfecta type 2
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
  • osteogenesis imperfecta type 3
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
  • osteogenesis imperfecta type 4
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, G2P, Orphanet
  • Ehlers-Danlos syndrome, classic type, 1
    Inheritance: AD Classification: MODERATE Submitted by: ClinGen
  • Ehlers-Danlos syndrome, classic type
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Ehlers-Danlos/osteogenesis imperfecta syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • high bone mass osteogenesis imperfecta
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.022525597 fraction of the gene. Cryptic splice site detected, with MaxEntScore 4, offset of 5, new splice context is: ccgGTgaag. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000088.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.
GeneTranscriptTagsHGVScHGVSpEffectExon RankProteinUniProt
COL1A1
NM_000088.4
MANE Select
c.1609_1614+25delGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGGp.Ala537_Lys538del
splice_donor conservative_inframe_deletion splice_region intron
Exon 23 of 51NP_000079.2P02452

Ensembl Transcripts

Sel.
GeneTranscriptTagsHGVScHGVSpEffectExon RankProteinUniProt
COL1A1
ENST00000225964.10
TSL:1 MANE Select
c.1609_1614+25delGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGGp.Ala537_Lys538del
splice_donor conservative_inframe_deletion splice_region intron
Exon 23 of 51ENSP00000225964.6P02452
COL1A1
ENST00000861334.1
c.1609_1614+25delGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGGp.Ala537_Lys538del
splice_donor conservative_inframe_deletion splice_region intron
Exon 23 of 51ENSP00000531393.1
COL1A1
ENST00000861339.1
c.1609_1614+25delGCCAAGGTGAGGCCCCAGGCTTTCAGCCTGGp.Ala537_Lys538del
splice_donor conservative_inframe_deletion splice_region intron
Exon 23 of 51ENSP00000531398.1

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name
Calibrated prediction
Score
Prediction
PhyloP100
0.45

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Publications

Other links and lift over

hg19: chr17-48271683; API
For research and educational, non-commercial use only. Not for clinical or diagnostic use. GeneBe does not provide medical advice. Data use for AI modeling is prohibited: if used, the cost is $0.001 per byte of downloaded uncompressed data.