chr6-82365309-GCTGGCGGAGCTGGCCGCGCTCAAC-G

Variant names:

• chr6-82365309-GCTGGCGGAGCTGGCCGCGCTCAAC-G
• rs2127872441
• NM_001376922.1:c.351_374delGGCGGAGCTGGCCGCGCTCAACCT

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001376922.1(TPBG):​c.351_374delGGCGGAGCTGGCCGCGCTCAACCT​(p.Ala118_Leu125del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: TPBG NM_001376922.1 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.07
• Publications: 0 publications found

Genes affected

TPBG (HGNC:12004): (trophoblast glycoprotein) This gene encodes a leucine-rich transmembrane glycoprotein that may be involved in cell adhesion. The encoded protein is an oncofetal antigen that is specific to trophoblast cells. In adults this protein is highly expressed in many tumor cells and is associated with poor clinical outcome in numerous cancers. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001376922.1.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001376922.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TPBG	NM_001376922.1	MANE Select	c.351_374delGGCGGAGCTGGCCGCGCTCAACCT	p.Ala118_Leu125del	disruptive_inframe_deletion	Exon 2 of 2	NP_001363851.1	Q13641
	TPBG	NM_001166392.2		c.351_374delGGCGGAGCTGGCCGCGCTCAACCT	p.Ala118_Leu125del	disruptive_inframe_deletion	Exon 2 of 2	NP_001159864.1	Q13641
	TPBG	NM_006670.5		c.351_374delGGCGGAGCTGGCCGCGCTCAACCT	p.Ala118_Leu125del	disruptive_inframe_deletion	Exon 3 of 3	NP_006661.1	Q13641

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TPBG	ENST00000369750.4	TSL:1 MANE Select	c.351_374delGGCGGAGCTGGCCGCGCTCAACCT	p.Ala118_Leu125del	disruptive_inframe_deletion	Exon 2 of 2	ENSP00000358765.4	Q13641
	TPBG	ENST00000535040.4	TSL:2	c.351_374delGGCGGAGCTGGCCGCGCTCAACCT	p.Ala118_Leu125del	disruptive_inframe_deletion	Exon 3 of 3	ENSP00000441219.1	Q13641
	TPBG	ENST00000543496.3	TSL:2	c.351_374delGGCGGAGCTGGCCGCGCTCAACCT	p.Ala118_Leu125del	disruptive_inframe_deletion	Exon 2 of 2	ENSP00000440049.1	Q13641

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs2127872441; hg19: chr6-83075026;