chrX-24364267-GCTGCTGCTGCTGCTGCTGCTGCTGCTG-G
Variant summary
Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3BS2
The NM_001136234.3(SUPT20HL1):c.1525_1551delGCTGCTGCTGCTGCTGCTGCTGCTGCT(p.Ala509_Ala517del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00053 in 803,955 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 125 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001136234.3 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001136234.3. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SUPT20HL1 | MANE Select | c.1525_1551delGCTGCTGCTGCTGCTGCTGCTGCTGCT | p.Ala509_Ala517del | conservative_inframe_deletion | Exon 1 of 1 | ENSP00000509731.1 | A0A7I2YQ69 | ||
| SUPT20HL1 | TSL:6 | c.1525_1551delGCTGCTGCTGCTGCTGCTGCTGCTGCT | p.Ala509_Ala517del | conservative_inframe_deletion | Exon 2 of 2 | ENSP00000502907.1 | A0A7I2YQ69 |
Frequencies
GnomAD3 genomes AF: 0.00145 AC: 119AN: 82144Hom.: 0 Cov.: 2 show subpopulations
GnomAD4 exome AF: 0.000425 AC: 307AN: 721803Hom.: 0 AF XY: 0.000412 AC XY: 93AN XY: 225473 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00145 AC: 119AN: 82152Hom.: 0 Cov.: 2 AF XY: 0.00166 AC XY: 32AN XY: 19302 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.