rs137854296
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_000548.5(TSC2):c.4241_4274delTTAAGGCCCGGTCACAGTCAGGGACCCTGGACGG(p.Val1414GlyfsTer51) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000548.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- tuberous sclerosisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- tuberous sclerosis 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, Ambry Genetics
- lymphangioleiomyomatosisInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- tuberous sclerosis complexInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000548.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | MANE Select | c.4241_4274delTTAAGGCCCGGTCACAGTCAGGGACCCTGGACGG | p.Val1414GlyfsTer51 | frameshift | Exon 34 of 42 | NP_000539.2 | P49815-1 | ||
| TSC2 | c.4238_4271delTTAAGGCCCGGTCACAGTCAGGGACCCTGGACGG | p.Val1413GlyfsTer51 | frameshift | Exon 34 of 42 | NP_001393592.1 | A0A2R8Y6C9 | |||
| TSC2 | c.4172_4205delTTAAGGCCCGGTCACAGTCAGGGACCCTGGACGG | p.Val1391GlyfsTer51 | frameshift | Exon 33 of 41 | NP_001107854.1 | P49815-4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | TSL:5 MANE Select | c.4241_4274delTTAAGGCCCGGTCACAGTCAGGGACCCTGGACGG | p.Val1414GlyfsTer51 | frameshift | Exon 34 of 42 | ENSP00000219476.3 | P49815-1 | ||
| TSC2 | TSL:1 | c.4172_4205delTTAAGGCCCGGTCACAGTCAGGGACCCTGGACGG | p.Val1391GlyfsTer51 | frameshift | Exon 33 of 41 | ENSP00000344383.4 | P49815-4 | ||
| TSC2 | TSL:1 | c.4040_4073delTTAAGGCCCGGTCACAGTCAGGGACCCTGGACGG | p.Val1347GlyfsTer51 | frameshift | Exon 32 of 40 | ENSP00000384468.2 | P49815-5 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.