rs1555803632

Variant names:

• chr19-11106438-TCCTGCCTTGGCCTCCCAAAGTGCTGGGATTCCAGGCATGAGCCGCTGCACCCGGCAAAAGGCCCTGCTTCTTTTTCTCTGGTTGTCTCTTCTTGAGAAAATCAACACACTCTGTCCTGTTTTCCAGCTGTGGCCACCTGTCGCCCTGACGAATTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGACTGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGGTGAGCGCTGGCCATCTGGTTTTCCATCCCCCATTCTCTGTGCCTTGCTGCTTGCAAATGATTTGTGAAGCCAGAGGGCGCTTCCCTGGTCAGCTCTGCACCAGCTGTGCGTCTGTGGGCAAGTGACTTGACTTCTCAGAGCCTCACTTCCTTTTGTTTTGAGACGGAGTCTCGCTCTGACACCCAGGCTGGAGTGCTGTGGCACAATCACAGCTCACGGCAGCCTCTGCCTCTGATGTCCAGTGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGAGATTAAAGGCGTATACCACCACGCCCGGCTAATTTTTTGTATTTTTATTAGAGACAGGGTTTCTCCATGTTGGCCAGGCTGGTCTTGAACTCCTGGTCTCAGGTGATCCACCCGCCTCGGCCTCCCAAAGTGCTAGGATTACAGGTGTGAGCCACTGCGCCAGGCCTAATTTTTTTGTATTTTTAGTAGAGATGCGGTTTTGCCATATTGCCCAGGCTGGTCTCGAACTCCTGGGCTCAAGCGATCTG-T
• NM_000527.5:c.695-96_818-151del

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate

The NM_000527.5(LDLR):​c.695-96_818-151del variant causes a exon loss, splice acceptor, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. The gene LDLR is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 32)
• Consequence: LDLR NM_000527.5 exon_loss, splice_acceptor, splice_donor, splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.61
• Publications: 0 publications found

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

LDLR Gene-Disease associations (from GenCC):

• hypercholesterolemia, familial, 1

  Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen
• homozygous familial hypercholesterolemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for LDLR are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.04761905 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000527.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDLR	NM_000527.5	MANE Select	c.695-96_818-151del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 5 of 18	NP_000518.1	P01130-1
	LDLR	NM_001195798.2		c.695-96_818-151del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 5 of 18	NP_001182727.1	P01130-5
	LDLR	NM_001195799.2		c.572-96_695-151del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 4 of 17	NP_001182728.1	P01130-4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDLR	ENST00000558518.6	TSL:1 MANE Select	c.695-126_818-181del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 5 of 18	ENSP00000454071.1	P01130-1
	LDLR	ENST00000252444.10	TSL:1	c.953-126_1076-181del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 5 of 18	ENSP00000252444.6	J3KMZ9
	LDLR	ENST00000558013.5	TSL:1	c.695-126_818-181del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 5 of 18	ENSP00000453346.1	P01130-5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

hg19: chr19-11217114;