rs1555803632

Variant names:

• chr19-11106438-TCCTGCCTTGGCCTCCCAAAGTGCTGGGATTCCAGGCATGAGCCGCTGCACCCGGCAAAAGGCCCTGCTTCTTTTTCTCTGGTTGTCTCTTCTTGAGAAAATCAACACACTCTGTCCTGTTTTCCAGCTGTGGCCACCTGTCGCCCTGACGAATTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGACTGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGGTGAGCGCTGGCCATCTGGTTTTCCATCCCCCATTCTCTGTGCCTTGCTGCTTGCAAATGATTTGTGAAGCCAGAGGGCGCTTCCCTGGTCAGCTCTGCACCAGCTGTGCGTCTGTGGGCAAGTGACTTGACTTCTCAGAGCCTCACTTCCTTTTGTTTTGAGACGGAGTCTCGCTCTGACACCCAGGCTGGAGTGCTGTGGCACAATCACAGCTCACGGCAGCCTCTGCCTCTGATGTCCAGTGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGAGATTAAAGGCGTATACCACCACGCCCGGCTAATTTTTTGTATTTTTATTAGAGACAGGGTTTCTCCATGTTGGCCAGGCTGGTCTTGAACTCCTGGTCTCAGGTGATCCACCCGCCTCGGCCTCCCAAAGTGCTAGGATTACAGGTGTGAGCCACTGCGCCAGGCCTAATTTTTTTGTATTTTTAGTAGAGATGCGGTTTTGCCATATTGCCCAGGCTGGTCTCGAACTCCTGGGCTCAAGCGATCTG-T
• rs1555803632
• NM_000527.5:c.695-96_818-151del

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_000527.5(LDLR):​c.695-96_818-151del variant causes a exon loss, splice acceptor, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: LDLR NM_000527.5 exon_loss, splice_acceptor, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 1.61

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.04761905 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LDLR	NM_000527.5	c.695-96_818-151del		exon_loss_variant, splice_acceptor_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 5 of 18	ENST00000558518.6	NP_000518.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LDLR	ENST00000558518.6	c.695-126_818-181del		exon_loss_variant, splice_acceptor_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 5 of 18	1	NM_000527.5	ENSP00000454071.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Hypercholesterolemia, familial, 1 Pathogenic:1

Jan 01, 1992

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555803632; hg19: chr19-11217114;