rs1555803632

chr19-11106438-TCCTGCCTTGGCCTCCCAAAGTGCTGGGATTCCAGGCATGAGCCGCTGCACCCGGCAAAAGGCCCTGCTTCTTTTTCTCTGGTTGTCTCTTCTTGAGAAAATCAACACACTCTGTCCTGTTTTCCAGCTGTGGCCACCTGTCGCCCTGACGAATTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGACTGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATGGTGAGCGCTGGCCATCTGGTTTTCCATCCCCCATTCTCTGTGCCTTGCTGCTTGCAAATGATTTGTGAAGCCAGAGGGCGCTTCCCTGGTCAGCTCTGCACCAGCTGTGCGTCTGTGGGCAAGTGACTTGACTTCTCAGAGCCTCACTTCCTTTTGTTTTGAGACGGAGTCTCGCTCTGACACCCAGGCTGGAGTGCTGTGGCACAATCACAGCTCACGGCAGCCTCTGCCTCTGATGTCCAGTGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGAGATTAAAGGCGTATACCACCACGCCCGGCTAATTTTTTGTATTTTTATTAGAGACAGGGTTTCTCCATGTTGGCCAGGCTGGTCTTGAACTCCTGGTCTCAGGTGATCCACCCGCCTCGGCCTCCCAAAGTGCTAGGATTACAGGTGTGAGCCACTGCGCCAGGCCTAATTTTTTTGTATTTTTAGTAGAGATGCGGTTTTGCCATATTGCCCAGGCTGGTCTCGAACTCCTGGGCTCAAGCGATCTG-T

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_000527.5(LDLR):c.695-96_818-151del variant causes a splice acceptor, splice donor, splice donor 5th base, coding sequence, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: LDLR NM_000527.5 splice_acceptor, splice_donor, splice_donor_5th_base, coding_sequence, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 1.61

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Splicing variant, NOT destroyed by nmd, known LOF gene, truncates exone, which is 0.0472319 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
LDLR	NM_000527.5	c.695-96_818-151del		splice_acceptor_variant, splice_donor_variant, splice_donor_5th_base_variant, coding_sequence_variant, intron_variant	5/18	ENST00000558518.6

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
LDLR	ENST00000558518.6	c.695-96_818-151del		splice_acceptor_variant, splice_donor_variant, splice_donor_5th_base_variant, coding_sequence_variant, intron_variant	5/18	1	NM_000527.5	P3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Hypercholesterolemia, familial, 1 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Jan 01, 1992

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555803632; hg19: chr19-11217114;