rs397517815

Variant names:

• chr2-178747082-A-ATATCGCTCTAGAGTCTCTCCTGGGGGTGTGGAG
• rs397517815
• NM_001267550.2:c.11312-5194_11312-5162dupCTCCACACCCCCAGGAGAGACTCTAGAGCGATA

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 2P and 12B. PM4 BP6_Very_Strong BS1

The NM_133379.5(TTN):​c.15285_15317dupCTCCACACCCCCAGGAGAGACTCTAGAGCGATA​(p.Tyr5106_Ser5107insSerThrProProGlyGluThrLeuGluArgTyr) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00259 in 148,292 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. Y5106Y) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0026 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0031 (8 hom.)
  • Failed GnomAD Quality Control
• Consequence: TTN NM_133379.5 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts U:1 B:11
• Conservation: PhyloP100: 0.853
• Publications: 0 publications found

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_133379.5.
• BP6: Variant 2-178747082-A-ATATCGCTCTAGAGTCTCTCCTGGGGGTGTGGAG is Benign according to our data. Variant chr2-178747082-A-ATATCGCTCTAGAGTCTCTCCTGGGGGTGTGGAG is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 47784.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population nfe. GnomAd4 allele frequency = 0.00259 (384/148292) while in subpopulation NFE AF = 0.00462 (308/66642). AF 95% confidence interval is 0.0042. There are 0 homozygotes in GnomAd4. There are 169 alleles in the male GnomAd4 subpopulation. Median coverage is 32. This position passed quality control check.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_133379.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	NM_001267550.2	MANE Select	c.11312-5194_11312-5162dupCTCCACACCCCCAGGAGAGACTCTAGAGCGATA		intron	N/A	NP_001254479.2	Q8WZ42-12
	TTN	NM_133379.5		c.15285_15317dupCTCCACACCCCCAGGAGAGACTCTAGAGCGATA	p.Tyr5106_Ser5107insSerThrProProGlyGluThrLeuGluArgTyr	disruptive_inframe_insertion	Exon 46 of 46	NP_596870.2	Q8WZ42-6
	TTN	NM_001256850.1		c.10361-5194_10361-5162dupCTCCACACCCCCAGGAGAGACTCTAGAGCGATA		intron	N/A	NP_001243779.1	Q8WZ42-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	ENST00000589042.5	TSL:5 MANE Select	c.11312-5194_11312-5162dupCTCCACACCCCCAGGAGAGACTCTAGAGCGATA		intron	N/A	ENSP00000467141.1	Q8WZ42-12
	TTN	ENST00000446966.2	TSL:1	c.11312-5194_11312-5162dupCTCCACACCCCCAGGAGAGACTCTAGAGCGATA		intron	N/A	ENSP00000408004.2	A0A1B0GXE3
	TTN	ENST00000436599.2	TSL:1	c.11036-5194_11036-5162dupCTCCACACCCCCAGGAGAGACTCTAGAGCGATA		intron	N/A	ENSP00000405517.2	A0A0C4DG59

Frequencies

GnomAD3 genomes AF: 0.00259 AC: 384 AN: 148172 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000501

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00201

Gnomad ASJ AF: 0.00117

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00174

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00462

Gnomad OTH AF: 0.00196

GnomAD2 exomes AF: 0.00270 AC: 673 AN: 249514 AF XY: 0.00261

Gnomad AFR exome AF: 0.000749

Gnomad AMR exome AF: 0.000960

Gnomad ASJ exome AF: 0.000505

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00186

Gnomad NFE exome AF: 0.00502

Gnomad OTH exome AF: 0.00248

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00312 AC: 4551 AN: 1458100 Hom.: 8 Cov.: 34 AF XY: 0.00306 AC XY: 2222 AN XY: 725458

African (AFR) AF: 0.000539 AC: 18 AN: 33390

American (AMR) AF: 0.00110 AC: 49 AN: 44594

Ashkenazi Jewish (ASJ) AF: 0.000500 AC: 13 AN: 26022

East Asian (EAS) AF: 0.00 AC: 0 AN: 39664

South Asian (SAS) AF: 0.0000696 AC: 6 AN: 86162

European-Finnish (FIN) AF: 0.00169 AC: 90 AN: 53322

Middle Eastern (MID) AF: 0.00122 AC: 7 AN: 5750

European-Non Finnish (NFE) AF: 0.00381 AC: 4220 AN: 1108944

Other (OTH) AF: 0.00246 AC: 148 AN: 60252

GnomAD4 genome AF: 0.00259 AC: 384 AN: 148292 Hom.: 0 Cov.: 32 AF XY: 0.00233 AC XY: 169 AN XY: 72482

African (AFR) AF: 0.000499 AC: 20 AN: 40050

American (AMR) AF: 0.00201 AC: 30 AN: 14940

Ashkenazi Jewish (ASJ) AF: 0.00117 AC: 4 AN: 3428

East Asian (EAS) AF: 0.00 AC: 0 AN: 4994

South Asian (SAS) AF: 0.00 AC: 0 AN: 4668

European-Finnish (FIN) AF: 0.00174 AC: 18 AN: 10334

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 280

European-Non Finnish (NFE) AF: 0.00462 AC: 308 AN: 66642

Other (OTH) AF: 0.00193 AC: 4 AN: 2070

Alfa AF: 0.00296 Hom.: 0

Asia WGS AF: 0.000866 AC: 3 AN: 3478

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	4	not provided (5)
-	-	4	not specified (4)
-	-	2	Autosomal recessive limb-girdle muscular dystrophy type 2J;C1838244:Tibial muscular dystrophy;C1858763:Dilated cardiomyopathy 1G;C1861065:Hypertrophic cardiomyopathy 9;C1863599:Myopathy, myofibrillar, 9, with early respiratory failure;C2673677:Early-onset myopathy with fatal cardiomyopathy (2)
-	-	1	TTN-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.85
Mutation Taster		=85/15	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397517815; hg19: chr2-179611809;