rs768951263
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000352.6(ABCC8):c.1254_1284dupTAATCTGGTTGCCATCGACACCAATCAGCTC(p.Met429fs) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000112 in 1,614,046 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. L428L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000352.6 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- hyperinsulinemic hypoglycemia, familial, 1Inheritance: AD, AR, SD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Illumina, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- diabetes mellitus, permanent neonatal 3Inheritance: AR, SD, AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- familial hyperinsulinismInheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- diabetes mellitusInheritance: SD Classification: DEFINITIVE Submitted by: Ambry Genetics
- monogenic diabetesInheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
- diabetes mellitus, noninsulin-dependentInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- hypoglycemia, leucine-inducedInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- transient neonatal diabetes mellitusInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
- permanent neonatal diabetes mellitusInheritance: AR, AD Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
- diabetes mellitus, transient neonatal, 2Inheritance: Unknown, AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- pulmonary arterial hypertensionInheritance: AD Classification: MODERATE Submitted by: ClinGen
- autosomal dominant hyperinsulinism due to SUR1 deficiencyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- DEND syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- diazoxide-resistant focal hyperinsulinism due to SUR1 deficiencyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- maturity-onset diabetes of the youngInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive hyperinsulinism due to SUR1 deficiencyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- type 2 diabetes mellitusInheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152164Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000159 AC: 4AN: 251476 AF XY: 0.0000147 show subpopulations
GnomAD4 exome AF: 0.0000116 AC: 17AN: 1461882Hom.: 0 Cov.: 31 AF XY: 0.0000138 AC XY: 10AN XY: 727244 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152164Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74316 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Submissions by phenotype
Hyperinsulinemic hypoglycemia, familial, 1 Pathogenic:2
- -
The Met429Ter variant in ABCC8 has been reported in at least 5 individuals with congenital hyperinsulinism (PMID: 25201519, 23345197, 23275527), and has been identified in 0.004% (4/113754) of European (non-Finnish) chromosomes by the Genome Aggregation Database (gnomAD, http://gnomad.broadinstitute.org; dbSNP rs768951263). Although this variant has been seen in the general population in a heterozygous state, its frequency is low enough to be consistent with a recessive carrier frequency. This variant has also been reported in ClinVar (VariationID: 434056) as pathogenic by Invitae, Genetic Services Laboratory (University of Chicago), Women's Health and Genetics/Laboratory Corporation of America (LabCorp), and Natera Inc. Of the 5 affected individuals, at least 1 was a compound heterozygote that carried a reported pathogenic variant in trans, which increases the likelihood that the Met429Ter variant is pathogenic (Variation ID: 370604; PMID: 23275527). This variant is predicted to cause a frameshift, which alters the protein’s amino acid sequence beginning at position 429 and leads to a premature termination codon 1 amino acid downstream. This alteration is then predicted to lead to a truncated or absent protein. Loss of function of the ABCC8 gene is an established disease mechanism in autosomal recessive hyperinsulinemic hypoglycemia. In summary, this variant meets criteria to be classified as pathogenic for autosomal recessive hyperinsulinemic hypoglycemia. ACMG/AMP Criteria applied: PVS1, PM3, PM2_supporting (Richards 2015). -
Familial hyperinsulinism Pathogenic:1
Variant summary: ABCC8 c.1254_1284dup31 (p.Met429X) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory. The variant allele was found at a frequency of 1.6e-05 in 251476 control chromosomes (gnomAD). c.1254_1284dup31 has been reported in the literature in multiple individuals affected with Congenital Hyperinsulinism (Banerjee_2011, Kapoor_2013, Snider_2013, Arya_2014, Demirbilek_2014). These data indicate that the variant is likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Three ClinVar submitters have assessed the variant since 2014: all three classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -
Type 2 diabetes mellitus Pathogenic:1
- -
Hereditary hyperinsulinism Pathogenic:1
- -
Type 2 diabetes mellitus;C0271714:Leucine-induced hypoglycemia;C1835887:Diabetes mellitus, transient neonatal, 2;C2931832:Hyperinsulinemic hypoglycemia, familial, 1;C5394303:Diabetes mellitus, permanent neonatal 3 Pathogenic:1
- -
not provided Pathogenic:1
This sequence change creates a premature translational stop signal (p.Met429*) in the ABCC8 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in ABCC8 are known to be pathogenic (PMID: 20685672, 23345197). This variant is present in population databases (rs768951263, gnomAD 0.004%). This premature translational stop signal has been observed in individual(s) with autosomal recessive diffuse or paternally inherited focal hyperinsulinism (PMID: 25201519). ClinVar contains an entry for this variant (Variation ID: 434055). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at