rs786204887

Variant names:

• chr10-87863375-ACTCTGCGCTCGCACCCAGAGCTACCG-A
• rs786203072
• NM_001126049.2:c.-914_-889delCGGTAGCTCTGGGTGCGAGCGCAGAG

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_001126049.2(KLLN):​c.-914_-889delCGGTAGCTCTGGGTGCGAGCGCAGAG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000792 in 340,856 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.000079 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000079 (0 hom.)
• Consequence: KLLN NM_001126049.2 5_prime_UTR
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:4 B:1
• Conservation: PhyloP100: 3.12

Genes affected

KLLN (HGNC:37212): (killin, p53 regulated DNA replication inhibitor) The protein encoded by this intronless gene is found in the nucleus, where it can inhibit DNA synthesis and promote S phase arrest coupled to apoptosis. The expression of this DNA binding protein is upregulated by transcription factor p53. [provided by RefSeq, Dec 2012]

PTEN (HGNC:9588): (phosphatase and tensin homolog) This gene was identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. The protein encoded by this gene is a phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase. It contains a tensin like domain as well as a catalytic domain similar to that of the dual specificity protein tyrosine phosphatases. Unlike most of the protein tyrosine phosphatases, this protein preferentially dephosphorylates phosphoinositide substrates. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway. The use of a non-canonical (CUG) upstream initiation site produces a longer isoform that initiates translation with a leucine, and is thought to be preferentially associated with the mitochondrial inner membrane. This longer isoform may help regulate energy metabolism in the mitochondria. A pseudogene of this gene is found on chromosome 9. Alternative splicing and the use of multiple translation start codons results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]

ENSG00000289051 (HGNC:55481):

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd4 at 12 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KLLN	NM_001126049.2	c.-914_-889delCGGTAGCTCTGGGTGCGAGCGCAGAG		5_prime_UTR_variant	Exon 1 of 1	ENST00000445946.5	NP_001119521.1
PTEN	NM_000314.8	c.-1094_-1069delCTCTGCGCTCGCACCCAGAGCTACCG		upstream_gene_variant		ENST00000371953.8	NP_000305.3
PTEN	NM_001304717.5	c.-574_-549delCTCTGCGCTCGCACCCAGAGCTACCG		upstream_gene_variant			NP_001291646.4
PTEN	NM_001304718.2	c.-1799_-1774delCTCTGCGCTCGCACCCAGAGCTACCG		upstream_gene_variant			NP_001291647.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KLLN	ENST00000445946.5	c.-914_-889delCGGTAGCTCTGGGTGCGAGCGCAGAG		5_prime_UTR_variant	Exon 1 of 1	6	NM_001126049.2	ENSP00000392204.2
PTEN	ENST00000371953.8	c.-1094_-1069delCTCTGCGCTCGCACCCAGAGCTACCG		upstream_gene_variant		1	NM_000314.8	ENSP00000361021.3
ENSG00000289051	ENST00000692337.1	c.-183_-158delCTCTGCGCTCGCACCCAGAGCTACCG		upstream_gene_variant				ENSP00000509326.1

Frequencies

GnomAD3 genomes AF: 0.0000790 AC: 12 AN: 151974 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000725

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000132

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000794 AC: 15 AN: 188882 Hom.: 0 AF XY: 0.0000734 AC XY: 7 AN XY: 95430

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000130

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000790 AC: 12 AN: 151974 Hom.: 0 Cov.: 32 AF XY: 0.0000674 AC XY: 5 AN XY: 74224

Gnomad4 AFR AF: 0.0000725

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000132

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000169 Hom.: 0

Bravo AF: 0.0000567

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:4 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:3

Apr 13, 2017

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: The PTEN variant c.-1087_1062del26 (alternatively also known as c.-1088_1063del26) is located within the promoter region of the gene (between -1344 bp and -745 bp upstream from initiation codon). Mutation taster predicts damaging outcome for this variant. This nucleotide position has no coverage in ExAC, NHLBI ESP and 1000 Genomes, however has been covered in gnomAD (1/30820 control chromosomes). The variant of interest has not, to our knowledge, been reported in literature/databases, nor evaluated for functional impact by in vivo/vitro studies. Two clinical laboratories in ClinVar have classified it as variant of uncertain significance. Several single nucleotide substitutions and deletion/duplication variants in promoter region are reported in patients with Cowden syndrome and known to decrease PTEN transcription (refs. ClinVar, HGMD, Zhou_2003, among others). Therefore this variant may also have similar outcome. Taken together, the variant is classified as a variant of uncertain significance (VUS) until additional information becomes available. -

Jun 16, 2021

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Describes a deletion of 26 nucleotides from 1063 to 1088 basepairs upstream of the ATG translational start site in the PTEN promoter region; Has not been previously published as pathogenic or benign to our knowledge; Variants within the PTEN promoter have been observed in individuals with features of Cowden syndrome (Zhou 2003); Also known as -1087_-1062del26; This variant is associated with the following publications: (PMID: 12844284) -

Aug 19, 2021

Quest Diagnostics Nichols Institute San Juan Capistrano

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

To the best of our knowledge, the variant has not been reported in the published literature. It also has not been reported in large, multi-ethnic general populations (http://gnomad.broadinstitute.org). Based on the available information, we are unable to determine the clinical significance of this variant. -

PTEN-related disorder Uncertain:1

Feb 06, 2023

PreventionGenetics, part of Exact Sciences

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The PTEN c.-1088_-1063del26 variant is located in the 5' untranslated region. To our knowledge, this variant has not been reported in the literature or in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -

Hereditary cancer-predisposing syndrome Benign:1

Jun 09, 2020

Ambry Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs786203072; hg19: chr10-89623132;