rs886037922

Positions:

• chr16-28938944-GCACCTGGAGCACCAGGTGATCCTCAGGT-GNNNNNNNNNNNNNNNNNNNNNNN

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4

The NM_001770.6(CD19):​c.1653_*9delCACCTGGAGCACCAGGTGATCCTCAGGTinsNNNNNNNNNNNNNNNNNNNNNNN​(p.Gly551fs) variant causes a frameshift, stop lost change. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 N/A (N/A hom., cov:)
  • Exomes 𝑓: N/A (N/A hom.)
• Consequence: CD19 NM_001770.6 frameshift, stop_lost
• Clinical Significance: Not reported in ClinVar
• Conservation: No conservation score assigned

Genes affected

CD19 (HGNC:1633): (CD19 molecule) This gene encodes a member of the immunoglobulin gene superfamily. Expression of this cell surface protein is restricted to B cell lymphocytes. This protein is a reliable marker for pre-B cells but its expression diminishes during terminal B cell differentiation in antibody secreting plasma cells. The protein has two N-terminal extracellular Ig-like domains separated by a non-Ig-like domain, a hydrophobic transmembrane domain, and a large C-terminal cytoplasmic domain. This protein forms a complex with several membrane proteins including complement receptor type 2 (CD21) and tetraspanin (CD81) and this complex reduces the threshold for antigen-initiated B cell activation. Activation of this B-cell antigen receptor complex activates the phosphatidylinositol 3-kinase signalling pathway and the subsequent release of intracellular stores of calcium ions. This protein is a target of chimeric antigen receptor (CAR) T-cells used in the treatment of lymphoblastic leukemia. Mutations in this gene are associated with the disease common variable immunodeficiency 3 (CVID3) which results in a failure of B-cell differentiation and impaired secretion of immunoglobulins. CVID3 is characterized by hypogammaglobulinemia, an inability to mount an antibody response to antigen, and recurrent bacterial infections. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2020]

CD19 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM4: Stoplost variant in NM_001770.6 Downstream stopcodon found after 33 codons.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CD19	NM_001770.6	c.1653_*9delCACCTGGAGCACCAGGTGATCCTCAGGTinsNNNNNNNNNNNNNNNNNNNNNNN	p.Gly551fs	frameshift_variant, stop_lost	14/15	ENST00000538922.8	NP_001761.3
CD19	NM_001770.6	c.1653_*9delCACCTGGAGCACCAGGTGATCCTCAGGTinsNNNNNNNNNNNNNNNNNNNNNNN		3_prime_UTR_variant	14/15	ENST00000538922.8	NP_001761.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CD19	ENST00000538922.8	c.1653_*9delCACCTGGAGCACCAGGTGATCCTCAGGTinsNNNNNNNNNNNNNNNNNNNNNNN	p.Gly551fs	frameshift_variant, stop_lost	14/15	5	NM_001770.6	ENSP00000437940.2
CD19	ENST00000538922.8	c.1653_*9delCACCTGGAGCACCAGGTGATCCTCAGGTinsNNNNNNNNNNNNNNNNNNNNNNN		3_prime_UTR_variant	14/15	5	NM_001770.6	ENSP00000437940.2

Frequencies

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

We have no GnomAD4 genomes data on this position. Probably position not covered by the project.

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr16-28950266;