← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 10-20785811-CCGTACATCCAGCCATCGTCAATAGGCTGCACGTTGACGATGTAGTCGCCGTCTCTAAA-C (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=10&pos=20785811&ref=CCGTACATCCAGCCATCGTCAATAGGCTGCACGTTGACGATGTAGTCGCCGTCTCTAAA&alt=C&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "10",
      "pos": 20785811,
      "ref": "CCGTACATCCAGCCATCGTCAATAGGCTGCACGTTGACGATGTAGTCGCCGTCTCTAAA",
      "alt": "C",
      "effect": "frameshift_variant",
      "transcript": "ENST00000377122.9",
      "consequences": [
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 28,
          "exon_rank_end": null,
          "exon_count": 28,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe975fs",
          "transcript": "NM_006393.3",
          "protein_id": "NP_006384.1",
          "transcript_support_level": null,
          "aa_start": 975,
          "aa_end": null,
          "aa_length": 1014,
          "cds_start": 2923,
          "cds_end": null,
          "cds_length": 3045,
          "cdna_start": 3086,
          "cdna_end": null,
          "cdna_length": 8925,
          "mane_select": "ENST00000377122.9",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 28,
          "exon_rank_end": null,
          "exon_count": 28,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe975fs",
          "transcript": "ENST00000377122.9",
          "protein_id": "ENSP00000366326.4",
          "transcript_support_level": 1,
          "aa_start": 975,
          "aa_end": null,
          "aa_length": 1014,
          "cds_start": 2923,
          "cds_end": null,
          "cds_length": 3045,
          "cdna_start": 3086,
          "cdna_end": null,
          "cdna_length": 8925,
          "mane_select": "NM_006393.3",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.691_748delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe231fs",
          "transcript": "ENST00000417816.2",
          "protein_id": "ENSP00000393896.2",
          "transcript_support_level": 1,
          "aa_start": 231,
          "aa_end": null,
          "aa_length": 270,
          "cds_start": 691,
          "cds_end": null,
          "cds_length": 813,
          "cdna_start": 1102,
          "cdna_end": null,
          "cdna_length": 3008,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.784_841delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe262fs",
          "transcript": "NM_001377322.1",
          "protein_id": "NP_001364251.1",
          "transcript_support_level": null,
          "aa_start": 262,
          "aa_end": null,
          "aa_length": 301,
          "cds_start": 784,
          "cds_end": null,
          "cds_length": 906,
          "cdna_start": 1099,
          "cdna_end": null,
          "cdna_length": 6938,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.691_748delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe231fs",
          "transcript": "NM_213569.2",
          "protein_id": "NP_998734.1",
          "transcript_support_level": null,
          "aa_start": 231,
          "aa_end": null,
          "aa_length": 270,
          "cds_start": 691,
          "cds_end": null,
          "cds_length": 813,
          "cdna_start": 1102,
          "cdna_end": null,
          "cdna_length": 6941,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.643_700delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe215fs",
          "transcript": "NM_001377323.1",
          "protein_id": "NP_001364252.1",
          "transcript_support_level": null,
          "aa_start": 215,
          "aa_end": null,
          "aa_length": 254,
          "cds_start": 643,
          "cds_end": null,
          "cds_length": 765,
          "cdna_start": 969,
          "cdna_end": null,
          "cdna_length": 6808,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.634_691delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe212fs",
          "transcript": "NM_001377324.1",
          "protein_id": "NP_001364253.1",
          "transcript_support_level": null,
          "aa_start": 212,
          "aa_end": null,
          "aa_length": 251,
          "cds_start": 634,
          "cds_end": null,
          "cds_length": 756,
          "cdna_start": 1107,
          "cdna_end": null,
          "cdna_length": 6946,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.625_682delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe209fs",
          "transcript": "NM_001377325.1",
          "protein_id": "NP_001364254.1",
          "transcript_support_level": null,
          "aa_start": 209,
          "aa_end": null,
          "aa_length": 248,
          "cds_start": 625,
          "cds_end": null,
          "cds_length": 747,
          "cdna_start": 951,
          "cdna_end": null,
          "cdna_length": 6790,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.583_640delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe195fs",
          "transcript": "NM_001377326.1",
          "protein_id": "NP_001364255.1",
          "transcript_support_level": null,
          "aa_start": 195,
          "aa_end": null,
          "aa_length": 234,
          "cds_start": 583,
          "cds_end": null,
          "cds_length": 705,
          "cdna_start": 900,
          "cdna_end": null,
          "cdna_length": 6739,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.583_640delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe195fs",
          "transcript": "NM_001377327.1",
          "protein_id": "NP_001364256.1",
          "transcript_support_level": null,
          "aa_start": 195,
          "aa_end": null,
          "aa_length": 234,
          "cds_start": 583,
          "cds_end": null,
          "cds_length": 705,
          "cdna_start": 1066,
          "cdna_end": null,
          "cdna_length": 6905,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.583_640delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe195fs",
          "transcript": "NM_001377328.1",
          "protein_id": "NP_001364257.1",
          "transcript_support_level": null,
          "aa_start": 195,
          "aa_end": null,
          "aa_length": 234,
          "cds_start": 583,
          "cds_end": null,
          "cds_length": 705,
          "cdna_start": 771,
          "cdna_end": null,
          "cdna_length": 6610,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 30,
          "exon_rank_end": null,
          "exon_count": 30,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.2875_2932delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe959fs",
          "transcript": "XM_011519291.3",
          "protein_id": "XP_011517593.1",
          "transcript_support_level": null,
          "aa_start": 959,
          "aa_end": null,
          "aa_length": 998,
          "cds_start": 2875,
          "cds_end": null,
          "cds_length": 2997,
          "cdna_start": 3369,
          "cdna_end": null,
          "cdna_length": 9208,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 31,
          "exon_rank_end": null,
          "exon_count": 31,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.2875_2932delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe959fs",
          "transcript": "XM_047424443.1",
          "protein_id": "XP_047280399.1",
          "transcript_support_level": null,
          "aa_start": 959,
          "aa_end": null,
          "aa_length": 998,
          "cds_start": 2875,
          "cds_end": null,
          "cds_length": 2997,
          "cdna_start": 3458,
          "cdna_end": null,
          "cdna_length": 9297,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 27,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.2821_2878delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe941fs",
          "transcript": "XM_005252342.6",
          "protein_id": "XP_005252399.1",
          "transcript_support_level": null,
          "aa_start": 941,
          "aa_end": null,
          "aa_length": 980,
          "cds_start": 2821,
          "cds_end": null,
          "cds_length": 2943,
          "cdna_start": 2984,
          "cdna_end": null,
          "cdna_length": 8823,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 26,
          "exon_rank_end": null,
          "exon_count": 26,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.2680_2737delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe894fs",
          "transcript": "XM_005252343.6",
          "protein_id": "XP_005252400.1",
          "transcript_support_level": null,
          "aa_start": 894,
          "aa_end": null,
          "aa_length": 933,
          "cds_start": 2680,
          "cds_end": null,
          "cds_length": 2802,
          "cdna_start": 2843,
          "cdna_end": null,
          "cdna_length": 8682,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "FRDGDYIVNVQPIDDGWMYG",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.934_991delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe312fs",
          "transcript": "XM_047424444.1",
          "protein_id": "XP_047280400.1",
          "transcript_support_level": null,
          "aa_start": 312,
          "aa_end": null,
          "aa_length": 351,
          "cds_start": 934,
          "cds_end": null,
          "cds_length": 1056,
          "cdna_start": 1345,
          "cdna_end": null,
          "cdna_length": 7184,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "n.899_956delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": null,
          "transcript": "ENST00000675114.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1104,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "n.714_771delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": null,
          "transcript": "ENST00000675700.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6533,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "n.970_1027delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": null,
          "transcript": "ENST00000675702.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6789,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.*14_*71delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": null,
          "transcript": "NM_001173484.2",
          "protein_id": "NP_001166955.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 224,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 675,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6843,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NEBL",
          "gene_hgnc_id": 16932,
          "hgvs_c": "c.*81_*138delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": null,
          "transcript": "ENST00000676125.1",
          "protein_id": "ENSP00000501594.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 212,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 639,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6618,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "NEBL",
      "gene_hgnc_id": 16932,
      "dbsnp": null,
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 9.325,
      "phylop100way_prediction": "Pathogenic",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 0,
      "acmg_classification": "Uncertain_significance",
      "acmg_criteria": "",
      "acmg_by_gene": [
        {
          "score": 0,
          "benign_score": 0,
          "pathogenic_score": 0,
          "criteria": [],
          "verdict": "Uncertain_significance",
          "transcript": "ENST00000377122.9",
          "gene_symbol": "NEBL",
          "hgnc_id": 16932,
          "effects": [
            "frameshift_variant"
          ],
          "inheritance_mode": "AD",
          "hgvs_c": "c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
          "hgvs_p": "p.Phe975fs"
        }
      ],
      "clinvar_disease": "Primary dilated cardiomyopathy",
      "clinvar_classification": "Uncertain significance",
      "clinvar_review_status": "criteria provided, single submitter",
      "clinvar_submissions_summary": "US:1",
      "phenotype_combined": "Primary dilated cardiomyopathy",
      "pathogenicity_classification_combined": "Uncertain significance",
      "custom_annotations": null
    }
  ],
  "message": null
}