← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 10-20785811-CCGTACATCCAGCCATCGTCAATAGGCTGCACGTTGACGATGTAGTCGCCGTCTCTAAA-C (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=10&pos=20785811&ref=CCGTACATCCAGCCATCGTCAATAGGCTGCACGTTGACGATGTAGTCGCCGTCTCTAAA&alt=C&genome=hg38&allGenes=true"
API Response
json
{
"variants": [
{
"chr": "10",
"pos": 20785811,
"ref": "CCGTACATCCAGCCATCGTCAATAGGCTGCACGTTGACGATGTAGTCGCCGTCTCTAAA",
"alt": "C",
"effect": "frameshift_variant",
"transcript": "ENST00000377122.9",
"consequences": [
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 28,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe975fs",
"transcript": "NM_006393.3",
"protein_id": "NP_006384.1",
"transcript_support_level": null,
"aa_start": 975,
"aa_end": null,
"aa_length": 1014,
"cds_start": 2923,
"cds_end": null,
"cds_length": 3045,
"cdna_start": 3086,
"cdna_end": null,
"cdna_length": 8925,
"mane_select": "ENST00000377122.9",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 28,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe975fs",
"transcript": "ENST00000377122.9",
"protein_id": "ENSP00000366326.4",
"transcript_support_level": 1,
"aa_start": 975,
"aa_end": null,
"aa_length": 1014,
"cds_start": 2923,
"cds_end": null,
"cds_length": 3045,
"cdna_start": 3086,
"cdna_end": null,
"cdna_length": 8925,
"mane_select": "NM_006393.3",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.691_748delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe231fs",
"transcript": "ENST00000417816.2",
"protein_id": "ENSP00000393896.2",
"transcript_support_level": 1,
"aa_start": 231,
"aa_end": null,
"aa_length": 270,
"cds_start": 691,
"cds_end": null,
"cds_length": 813,
"cdna_start": 1102,
"cdna_end": null,
"cdna_length": 3008,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.784_841delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe262fs",
"transcript": "NM_001377322.1",
"protein_id": "NP_001364251.1",
"transcript_support_level": null,
"aa_start": 262,
"aa_end": null,
"aa_length": 301,
"cds_start": 784,
"cds_end": null,
"cds_length": 906,
"cdna_start": 1099,
"cdna_end": null,
"cdna_length": 6938,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.691_748delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe231fs",
"transcript": "NM_213569.2",
"protein_id": "NP_998734.1",
"transcript_support_level": null,
"aa_start": 231,
"aa_end": null,
"aa_length": 270,
"cds_start": 691,
"cds_end": null,
"cds_length": 813,
"cdna_start": 1102,
"cdna_end": null,
"cdna_length": 6941,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.643_700delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe215fs",
"transcript": "NM_001377323.1",
"protein_id": "NP_001364252.1",
"transcript_support_level": null,
"aa_start": 215,
"aa_end": null,
"aa_length": 254,
"cds_start": 643,
"cds_end": null,
"cds_length": 765,
"cdna_start": 969,
"cdna_end": null,
"cdna_length": 6808,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.634_691delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe212fs",
"transcript": "NM_001377324.1",
"protein_id": "NP_001364253.1",
"transcript_support_level": null,
"aa_start": 212,
"aa_end": null,
"aa_length": 251,
"cds_start": 634,
"cds_end": null,
"cds_length": 756,
"cdna_start": 1107,
"cdna_end": null,
"cdna_length": 6946,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.625_682delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe209fs",
"transcript": "NM_001377325.1",
"protein_id": "NP_001364254.1",
"transcript_support_level": null,
"aa_start": 209,
"aa_end": null,
"aa_length": 248,
"cds_start": 625,
"cds_end": null,
"cds_length": 747,
"cdna_start": 951,
"cdna_end": null,
"cdna_length": 6790,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.583_640delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe195fs",
"transcript": "NM_001377326.1",
"protein_id": "NP_001364255.1",
"transcript_support_level": null,
"aa_start": 195,
"aa_end": null,
"aa_length": 234,
"cds_start": 583,
"cds_end": null,
"cds_length": 705,
"cdna_start": 900,
"cdna_end": null,
"cdna_length": 6739,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.583_640delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe195fs",
"transcript": "NM_001377327.1",
"protein_id": "NP_001364256.1",
"transcript_support_level": null,
"aa_start": 195,
"aa_end": null,
"aa_length": 234,
"cds_start": 583,
"cds_end": null,
"cds_length": 705,
"cdna_start": 1066,
"cdna_end": null,
"cdna_length": 6905,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.583_640delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe195fs",
"transcript": "NM_001377328.1",
"protein_id": "NP_001364257.1",
"transcript_support_level": null,
"aa_start": 195,
"aa_end": null,
"aa_length": 234,
"cds_start": 583,
"cds_end": null,
"cds_length": 705,
"cdna_start": 771,
"cdna_end": null,
"cdna_length": 6610,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 30,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.2875_2932delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe959fs",
"transcript": "XM_011519291.3",
"protein_id": "XP_011517593.1",
"transcript_support_level": null,
"aa_start": 959,
"aa_end": null,
"aa_length": 998,
"cds_start": 2875,
"cds_end": null,
"cds_length": 2997,
"cdna_start": 3369,
"cdna_end": null,
"cdna_length": 9208,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 31,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.2875_2932delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe959fs",
"transcript": "XM_047424443.1",
"protein_id": "XP_047280399.1",
"transcript_support_level": null,
"aa_start": 959,
"aa_end": null,
"aa_length": 998,
"cds_start": 2875,
"cds_end": null,
"cds_length": 2997,
"cdna_start": 3458,
"cdna_end": null,
"cdna_length": 9297,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 27,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.2821_2878delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe941fs",
"transcript": "XM_005252342.6",
"protein_id": "XP_005252399.1",
"transcript_support_level": null,
"aa_start": 941,
"aa_end": null,
"aa_length": 980,
"cds_start": 2821,
"cds_end": null,
"cds_length": 2943,
"cdna_start": 2984,
"cdna_end": null,
"cdna_length": 8823,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 26,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.2680_2737delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe894fs",
"transcript": "XM_005252343.6",
"protein_id": "XP_005252400.1",
"transcript_support_level": null,
"aa_start": 894,
"aa_end": null,
"aa_length": 933,
"cds_start": 2680,
"cds_end": null,
"cds_length": 2802,
"cdna_start": 2843,
"cdna_end": null,
"cdna_length": 8682,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FRDGDYIVNVQPIDDGWMYG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.934_991delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe312fs",
"transcript": "XM_047424444.1",
"protein_id": "XP_047280400.1",
"transcript_support_level": null,
"aa_start": 312,
"aa_end": null,
"aa_length": 351,
"cds_start": 934,
"cds_end": null,
"cds_length": 1056,
"cdna_start": 1345,
"cdna_end": null,
"cdna_length": 7184,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "n.899_956delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": null,
"transcript": "ENST00000675114.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1104,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "n.714_771delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": null,
"transcript": "ENST00000675700.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6533,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "n.970_1027delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": null,
"transcript": "ENST00000675702.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6789,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.*14_*71delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": null,
"transcript": "NM_001173484.2",
"protein_id": "NP_001166955.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 224,
"cds_start": -4,
"cds_end": null,
"cds_length": 675,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6843,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"hgvs_c": "c.*81_*138delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": null,
"transcript": "ENST00000676125.1",
"protein_id": "ENSP00000501594.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 212,
"cds_start": -4,
"cds_end": null,
"cds_length": 639,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6618,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "NEBL",
"gene_hgnc_id": 16932,
"dbsnp": null,
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 9.325,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 0,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "",
"acmg_by_gene": [
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000377122.9",
"gene_symbol": "NEBL",
"hgnc_id": 16932,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AD",
"hgvs_c": "c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG",
"hgvs_p": "p.Phe975fs"
}
],
"clinvar_disease": "Primary dilated cardiomyopathy",
"clinvar_classification": "Uncertain significance",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "US:1",
"phenotype_combined": "Primary dilated cardiomyopathy",
"pathogenicity_classification_combined": "Uncertain significance",
"custom_annotations": null
}
],
"message": null
}