10-20785811-CCGTACATCCAGCCATCGTCAATAGGCTGCACGTTGACGATGTAGTCGCCGTCTCTAAA-C

Variant names:

• chr10-20785811-CCGTACATCCAGCCATCGTCAATAGGCTGCACGTTGACGATGTAGTCGCCGTCTCTAAA-C
• NM_006393.3:c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_006393.3(NEBL):​c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG​(p.Phe975AlafsTer38) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: NEBL NM_006393.3 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.32
• Publications: 0 publications found

Genes affected

NEBL (HGNC:16932): (nebulette) This gene encodes a nebulin like protein that is abundantly expressed in cardiac muscle. The encoded protein binds actin and interacts with thin filaments and Z-line associated proteins in striated muscle. This protein may be involved in cardiac myofibril assembly. A shorter isoform of this protein termed LIM nebulette is expressed in non-muscle cells and may function as a component of focal adhesion complexes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]

NEBL Gene-Disease associations (from GenCC):

• dilated cardiomyopathy

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006393.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NEBL	NM_006393.3	MANE Select	c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG	p.Phe975AlafsTer38	frameshift	Exon 28 of 28	NP_006384.1	O76041-1
	NEBL	NM_001377322.1		c.784_841delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG	p.Phe262AlafsTer38	frameshift	Exon 8 of 8	NP_001364251.1
	NEBL	NM_213569.2		c.691_748delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG	p.Phe231AlafsTer38	frameshift	Exon 7 of 7	NP_998734.1	Q59FZ8

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NEBL	ENST00000377122.9	TSL:1 MANE Select	c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG	p.Phe975AlafsTer38	frameshift	Exon 28 of 28	ENSP00000366326.4	O76041-1
	NEBL	ENST00000417816.2	TSL:1	c.691_748delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG	p.Phe231AlafsTer38	frameshift	Exon 7 of 7	ENSP00000393896.2	O76041-2
	NEBL	ENST00000863069.1		c.2932_2989delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG	p.Phe978AlafsTer38	frameshift	Exon 28 of 28	ENSP00000533128.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Primary dilated cardiomyopathy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr10-21074740;