10-20785811-CCGTACATCCAGCCATCGTCAATAGGCTGCACGTTGACGATGTAGTCGCCGTCTCTAAA-C

Variant names:

• chr10-20785811-CCGTACATCCAGCCATCGTCAATAGGCTGCACGTTGACGATGTAGTCGCCGTCTCTAAA-C
• NM_006393.3:c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_006393.3(NEBL):​c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG​(p.Phe975AlafsTer38) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: NEBL NM_006393.3 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.32
• Publications: 0 publications found

Genes affected

NEBL (HGNC:16932): (nebulette) This gene encodes a nebulin like protein that is abundantly expressed in cardiac muscle. The encoded protein binds actin and interacts with thin filaments and Z-line associated proteins in striated muscle. This protein may be involved in cardiac myofibril assembly. A shorter isoform of this protein termed LIM nebulette is expressed in non-muscle cells and may function as a component of focal adhesion complexes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]

NEBL Gene-Disease associations (from GenCC):

• dilated cardiomyopathy

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NEBL	NM_006393.3	c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG	p.Phe975AlafsTer38	frameshift_variant	Exon 28 of 28	ENST00000377122.9	NP_006384.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NEBL	ENST00000377122.9	c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG	p.Phe975AlafsTer38	frameshift_variant	Exon 28 of 28	1	NM_006393.3	ENSP00000366326.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Primary dilated cardiomyopathy Uncertain:1

Dec 16, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Phe975Alafs*38) in the NEBL gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 40 amino acid(s) of the NEBL protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with NEBL-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr10-21074740;