← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 20-37179358-T-TGGCGCCGCCGGGTGAGGAGTTGCGCGTGG (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=20&pos=37179358&ref=T&alt=TGGCGCCGCCGGGTGAGGAGTTGCGCGTGG&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "20",
"pos": 37179358,
"ref": "T",
"alt": "TGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"effect": "frameshift_variant",
"transcript": "NM_152503.8",
"consequences": [
{
"aa_ref": "H",
"aa_alt": "PTRNSSPGGA?",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 25,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MROH8",
"gene_hgnc_id": 16125,
"hgvs_c": "c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC",
"hgvs_p": "p.His41fs",
"transcript": "NM_152503.8",
"protein_id": "NP_689716.4",
"transcript_support_level": null,
"aa_start": 41,
"aa_end": null,
"aa_length": 1042,
"cds_start": 121,
"cds_end": null,
"cds_length": 3129,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "ENST00000710289.2",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_152503.8"
},
{
"aa_ref": "H",
"aa_alt": "PTRNSSPGGA?",
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 25,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MROH8",
"gene_hgnc_id": 16125,
"hgvs_c": "c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC",
"hgvs_p": "p.His41fs",
"transcript": "ENST00000343811.10",
"protein_id": "ENSP00000513568.1",
"transcript_support_level": 1,
"aa_start": 41,
"aa_end": null,
"aa_length": 1042,
"cds_start": 121,
"cds_end": null,
"cds_length": 3129,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000343811.10"
},
{
"aa_ref": "H",
"aa_alt": "PTRNSSPGGA?",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MROH8",
"gene_hgnc_id": 16125,
"hgvs_c": "c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC",
"hgvs_p": "p.His41fs",
"transcript": "ENST00000400440.7",
"protein_id": "ENSP00000513569.1",
"transcript_support_level": 1,
"aa_start": 41,
"aa_end": null,
"aa_length": 598,
"cds_start": 121,
"cds_end": null,
"cds_length": 1797,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000400440.7"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.3_13+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "NM_002951.5",
"protein_id": "NP_002942.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 631,
"cds_start": null,
"cds_end": null,
"cds_length": 1896,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "ENST00000237530.11",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_002951.5"
},
{
"aa_ref": "H",
"aa_alt": "PTRNSSPGGA?",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MROH8",
"gene_hgnc_id": 16125,
"hgvs_c": "c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC",
"hgvs_p": "p.His41fs",
"transcript": "ENST00000422138.2",
"protein_id": "ENSP00000400468.2",
"transcript_support_level": 3,
"aa_start": 41,
"aa_end": null,
"aa_length": 956,
"cds_start": 121,
"cds_end": null,
"cds_length": 2871,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000422138.2"
},
{
"aa_ref": "H",
"aa_alt": "PTRNSSPGGA?",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MROH8",
"gene_hgnc_id": 16125,
"hgvs_c": "c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC",
"hgvs_p": "p.His41fs",
"transcript": "NM_213631.3",
"protein_id": "NP_998796.1",
"transcript_support_level": null,
"aa_start": 41,
"aa_end": null,
"aa_length": 598,
"cds_start": 121,
"cds_end": null,
"cds_length": 1797,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_213631.3"
},
{
"aa_ref": "H",
"aa_alt": "PTRNSSPGGA?",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MROH8",
"gene_hgnc_id": 16125,
"hgvs_c": "c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC",
"hgvs_p": "p.His41fs",
"transcript": "NM_213632.3",
"protein_id": "NP_998797.2",
"transcript_support_level": null,
"aa_start": 41,
"aa_end": null,
"aa_length": 563,
"cds_start": 121,
"cds_end": null,
"cds_length": 1692,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_213632.3"
},
{
"aa_ref": "H",
"aa_alt": "PTRNSSPGGA?",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MROH8",
"gene_hgnc_id": 16125,
"hgvs_c": "c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC",
"hgvs_p": "p.His41fs",
"transcript": "ENST00000421643.2",
"protein_id": "ENSP00000513570.1",
"transcript_support_level": 2,
"aa_start": 41,
"aa_end": null,
"aa_length": 563,
"cds_start": 121,
"cds_end": null,
"cds_length": 1692,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000421643.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000705448.1",
"protein_id": "ENSP00000516126.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 654,
"cds_start": null,
"cds_end": null,
"cds_length": 1965,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000705448.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892620.1",
"protein_id": "ENSP00000562679.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 647,
"cds_start": null,
"cds_end": null,
"cds_length": 1944,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892620.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892624.1",
"protein_id": "ENSP00000562683.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 645,
"cds_start": null,
"cds_end": null,
"cds_length": 1938,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892624.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892623.1",
"protein_id": "ENSP00000562682.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 634,
"cds_start": null,
"cds_end": null,
"cds_length": 1905,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892623.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892626.1",
"protein_id": "ENSP00000562685.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 629,
"cds_start": null,
"cds_end": null,
"cds_length": 1890,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892626.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892628.1",
"protein_id": "ENSP00000562687.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 625,
"cds_start": null,
"cds_end": null,
"cds_length": 1878,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892628.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892621.1",
"protein_id": "ENSP00000562680.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 618,
"cds_start": null,
"cds_end": null,
"cds_length": 1857,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892621.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892629.1",
"protein_id": "ENSP00000562688.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 617,
"cds_start": null,
"cds_end": null,
"cds_length": 1854,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892629.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000373622.9",
"protein_id": "ENSP00000362724.5",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 615,
"cds_start": null,
"cds_end": null,
"cds_length": 1848,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000373622.9"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892625.1",
"protein_id": "ENSP00000562684.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 615,
"cds_start": null,
"cds_end": null,
"cds_length": 1848,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892625.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892633.1",
"protein_id": "ENSP00000562692.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 612,
"cds_start": null,
"cds_end": null,
"cds_length": 1839,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892633.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892632.1",
"protein_id": "ENSP00000562691.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 602,
"cds_start": null,
"cds_end": null,
"cds_length": 1809,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892632.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892630.1",
"protein_id": "ENSP00000562689.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 599,
"cds_start": null,
"cds_end": null,
"cds_length": 1800,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892630.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892622.1",
"protein_id": "ENSP00000562681.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 572,
"cds_start": null,
"cds_end": null,
"cds_length": 1719,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892622.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000914582.1",
"protein_id": "ENSP00000584641.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 515,
"cds_start": null,
"cds_end": null,
"cds_length": 1548,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000914582.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892631.1",
"protein_id": "ENSP00000562690.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 470,
"cds_start": null,
"cds_end": null,
"cds_length": 1413,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892631.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000914583.1",
"protein_id": "ENSP00000584642.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 411,
"cds_start": null,
"cds_end": null,
"cds_length": 1236,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000914583.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000947422.1",
"protein_id": "ENSP00000617481.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 352,
"cds_start": null,
"cds_end": null,
"cds_length": 1059,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000947422.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-58_-57insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000892627.1",
"protein_id": "ENSP00000562686.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 336,
"cds_start": null,
"cds_end": null,
"cds_length": 1011,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000892627.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.3_13+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "NM_001324301.2",
"protein_id": "NP_001311230.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 663,
"cds_start": null,
"cds_end": null,
"cds_length": 1992,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001324301.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.3_13+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "NM_001324304.2",
"protein_id": "NP_001311233.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 647,
"cds_start": null,
"cds_end": null,
"cds_length": 1944,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001324304.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.3_13+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "NM_001324305.2",
"protein_id": "NP_001311234.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 647,
"cds_start": null,
"cds_end": null,
"cds_length": 1944,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001324305.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.3_13+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "NM_001324303.2",
"protein_id": "NP_001311232.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 638,
"cds_start": null,
"cds_end": null,
"cds_length": 1917,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001324303.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.3_13+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "NM_001135771.3",
"protein_id": "NP_001129243.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 615,
"cds_start": null,
"cds_end": null,
"cds_length": 1848,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001135771.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.3_13+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "NM_001324299.2",
"protein_id": "NP_001311228.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 615,
"cds_start": null,
"cds_end": null,
"cds_length": 1848,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001324299.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.3_13+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "NM_001324302.2",
"protein_id": "NP_001311231.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 599,
"cds_start": null,
"cds_end": null,
"cds_length": 1800,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001324302.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-197_-187+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "NM_001324306.2",
"protein_id": "NP_001311235.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 490,
"cds_start": null,
"cds_end": null,
"cds_length": 1473,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001324306.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.-187+785_-187+786insGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "ENST00000456102.5",
"protein_id": "ENSP00000399137.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": 165,
"cds_start": null,
"cds_end": null,
"cds_length": 500,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000456102.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.3_13+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "XM_006723851.4",
"protein_id": "XP_006723914.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 631,
"cds_start": null,
"cds_end": null,
"cds_length": 1896,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_006723851.4"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RPN2",
"gene_hgnc_id": 10382,
"hgvs_c": "c.3_13+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null,
"transcript": "XM_006723852.4",
"protein_id": "XP_006723915.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 615,
"cds_start": null,
"cds_end": null,
"cds_length": 1848,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_006723852.4"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MROH8",
"gene_hgnc_id": 16125,
"hgvs_c": "n.-49_-21dupCCACGCGCAACTCCTCACCCGGCGGCGCC",
"hgvs_p": null,
"transcript": "ENST00000434295.5",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000434295.5"
}
],
"gene_symbol": "MROH8",
"gene_hgnc_id": 16125,
"dbsnp": "rs1064792904",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 4.135,
"phylop100way_prediction": "Uncertain_significance",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -2,
"acmg_classification": "Likely_benign",
"acmg_criteria": "BP6_Moderate",
"acmg_by_gene": [
{
"score": -2,
"benign_score": 2,
"pathogenic_score": 0,
"criteria": [
"BP6_Moderate"
],
"verdict": "Likely_benign",
"transcript": "NM_152503.8",
"gene_symbol": "MROH8",
"hgnc_id": 16125,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AR",
"hgvs_c": "c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC",
"hgvs_p": "p.His41fs"
},
{
"score": -2,
"benign_score": 2,
"pathogenic_score": 0,
"criteria": [
"BP6_Moderate"
],
"verdict": "Likely_benign",
"transcript": "NM_001324301.2",
"gene_symbol": "RPN2",
"hgnc_id": 10382,
"effects": [
"intron_variant"
],
"inheritance_mode": "AR",
"hgvs_c": "c.3_13+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG",
"hgvs_p": null
}
],
"clinvar_disease": "not specified",
"clinvar_classification": "Benign",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "B:1",
"phenotype_combined": "not specified",
"pathogenicity_classification_combined": "Benign",
"custom_annotations": null
}
],
"message": null
}