20-37179358-T-TGGCGCCGCCGGGTGAGGAGTTGCGCGTGG

Variant names:

• chr20-37179358-T-TGGCGCCGCCGGGTGAGGAGTTGCGCGTGG
• rs1064792904
• ENST00000343811.10:c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC

Variant summary

Our verdict is Likely benign. Variant got -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_152503.8(MROH8):​c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC​(p.His41ProfsTer51) variant causes a frameshift change. Variant has been reported in ClinVar as Benign (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 0)
• Consequence: MROH8 NM_152503.8 frameshift
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 4.13

Genes affected

MROH8 (HGNC:16125): (maestro heat like repeat family member 8) The protein encoded by this gene belongs to the maestro heat-like repeat family. The exact function of this gene is not known, however, in a genome-wide association study using hippocampal atrophy as a quantitative trait, this gene has been associated with Alzheimer's disease (PMID:19668339). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

RPN2 (HGNC:10382): (ribophorin II) This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein is similar in sequence to the yeast oligosaccharyl transferase subunit SWP1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Likely_benign. Variant got -2 ACMG points.

• BP6: Variant 20-37179358-T-TGGCGCCGCCGGGTGAGGAGTTGCGCGTGG is Benign according to our data. Variant chr20-37179358-T-TGGCGCCGCCGGGTGAGGAGTTGCGCGTGG is described in ClinVar as [Benign]. Clinvar id is 403105.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RPN2	NM_002951.5	c.3_13+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG		intron_variant	Intron 1 of 16	ENST00000237530.11	NP_002942.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MROH8	ENST00000343811.10	c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC	p.His41ProfsTer51	frameshift_variant	Exon 2 of 25	1		ENSP00000513568.1

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome Cov.: 13

GnomAD4 genome Cov.: 0

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Benign:1

Mar 29, 2016

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant identified in a genome or exome case(s) and assessed due to predicted null impact of the variant or pathogenic assertions in the literature or databases. Disclaimer: This variant has not undergone full assessment. The following are preliminary notes: Frequency -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064792904; hg19: chr20-35807761;