← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 20-63659405-G-GCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=20&pos=63659405&ref=G&alt=GCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "20",
"pos": 63659405,
"ref": "G",
"alt": "GCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"effect": "frameshift_variant",
"transcript": "NM_001283009.2",
"consequences": [
{
"aa_ref": "Q",
"aa_alt": "PQDSPEWCDRRLPFP?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 35,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": "p.Gln16fs",
"transcript": "NM_001283009.2",
"protein_id": "NP_001269938.1",
"transcript_support_level": null,
"aa_start": 16,
"aa_end": null,
"aa_length": 1300,
"cds_start": 47,
"cds_end": null,
"cds_length": 3903,
"cdna_start": 372,
"cdna_end": null,
"cdna_length": 4615,
"mane_select": "ENST00000360203.11",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "Q",
"aa_alt": "PQDSPEWCDRRLPFP?",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 35,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": "p.Gln16fs",
"transcript": "ENST00000360203.11",
"protein_id": "ENSP00000353332.5",
"transcript_support_level": 5,
"aa_start": 16,
"aa_end": null,
"aa_length": 1300,
"cds_start": 47,
"cds_end": null,
"cds_length": 3903,
"cdna_start": 372,
"cdna_end": null,
"cdna_length": 4615,
"mane_select": "NM_001283009.2",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "Q",
"aa_alt": "PQDSPEWCDRRLPFP?",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 35,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": "p.Gln16fs",
"transcript": "ENST00000508582.7",
"protein_id": "ENSP00000424307.2",
"transcript_support_level": 2,
"aa_start": 16,
"aa_end": null,
"aa_length": 1243,
"cds_start": 47,
"cds_end": null,
"cds_length": 3732,
"cdna_start": 372,
"cdna_end": null,
"cdna_length": 4517,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "Q",
"aa_alt": "PQDSPEWCDRRLPFP?",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 35,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": "p.Gln16fs",
"transcript": "ENST00000370018.7",
"protein_id": "ENSP00000359035.3",
"transcript_support_level": 1,
"aa_start": 16,
"aa_end": null,
"aa_length": 1219,
"cds_start": 47,
"cds_end": null,
"cds_length": 3660,
"cdna_start": 874,
"cdna_end": null,
"cdna_length": 4955,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "Q",
"aa_alt": "PQDSPEWCDRRLPFP?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": "p.Gln16fs",
"transcript": "ENST00000356810.5",
"protein_id": "ENSP00000349265.4",
"transcript_support_level": 1,
"aa_start": 16,
"aa_end": null,
"aa_length": 355,
"cds_start": 47,
"cds_end": null,
"cds_length": 1069,
"cdna_start": 317,
"cdna_end": null,
"cdna_length": 1339,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 35,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1-TNFRSF6B",
"gene_hgnc_id": 44095,
"hgvs_c": "n.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": null,
"transcript": "ENST00000492259.6",
"protein_id": "ENSP00000457428.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4824,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "Q",
"aa_alt": "PQDSPEWCDRRLPFP?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 35,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": "p.Gln16fs",
"transcript": "NM_032957.5",
"protein_id": "NP_116575.3",
"transcript_support_level": null,
"aa_start": 16,
"aa_end": null,
"aa_length": 1243,
"cds_start": 47,
"cds_end": null,
"cds_length": 3732,
"cdna_start": 372,
"cdna_end": null,
"cdna_length": 4517,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "Q",
"aa_alt": "PQDSPEWCDRRLPFP?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 35,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": "p.Gln16fs",
"transcript": "NM_016434.4",
"protein_id": "NP_057518.1",
"transcript_support_level": null,
"aa_start": 16,
"aa_end": null,
"aa_length": 1219,
"cds_start": 47,
"cds_end": null,
"cds_length": 3660,
"cdna_start": 372,
"cdna_end": null,
"cdna_length": 4445,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "Q",
"aa_alt": "PQDSPEWCDRRLPFP?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": "p.Gln16fs",
"transcript": "ENST00000646389.1",
"protein_id": "ENSP00000494280.1",
"transcript_support_level": null,
"aa_start": 16,
"aa_end": null,
"aa_length": 88,
"cds_start": 47,
"cds_end": null,
"cds_length": 267,
"cdna_start": 350,
"cdna_end": null,
"cdna_length": 570,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "n.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": null,
"transcript": "ENST00000469728.5",
"protein_id": "ENSP00000496027.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 601,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 32,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "n.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": null,
"transcript": "ENST00000482936.6",
"protein_id": "ENSP00000457868.2",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3474,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "n.274_316dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": null,
"transcript": "ENST00000488316.2",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 685,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "n.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": null,
"transcript": "ENST00000684971.1",
"protein_id": "ENSP00000513449.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1714,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "n.322_364dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": null,
"transcript": "ENST00000686756.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2398,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "n.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": null,
"transcript": "ENST00000692658.1",
"protein_id": "ENSP00000513448.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1859,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "n.731_773dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": null,
"transcript": "ENST00000692911.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2127,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 38,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RTEL1-TNFRSF6B",
"gene_hgnc_id": 44095,
"hgvs_c": "n.831_873dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": null,
"transcript": "NR_037882.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5772,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 34,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "c.-568+947_-568+989dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": null,
"transcript": "NM_001283010.1",
"protein_id": "NP_001269939.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 996,
"cds_start": -4,
"cds_end": null,
"cds_length": 2991,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4676,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 34,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"hgvs_c": "c.-568+947_-568+989dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": null,
"transcript": "ENST00000318100.9",
"protein_id": "ENSP00000322287.5",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 996,
"cds_start": -4,
"cds_end": null,
"cds_length": 2991,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4162,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "RTEL1",
"gene_hgnc_id": 15888,
"dbsnp": "rs2146141304",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 4.147,
"phylop100way_prediction": "Uncertain_significance",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 10,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Moderate",
"acmg_by_gene": [
{
"score": 10,
"benign_score": 0,
"pathogenic_score": 10,
"criteria": [
"PVS1",
"PP5_Moderate"
],
"verdict": "Pathogenic",
"transcript": "NM_001283009.2",
"gene_symbol": "RTEL1",
"hgnc_id": 15888,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AR,AD",
"hgvs_c": "c.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": "p.Gln16fs"
},
{
"score": 2,
"benign_score": 0,
"pathogenic_score": 2,
"criteria": [
"PP5_Moderate"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000492259.6",
"gene_symbol": "RTEL1-TNFRSF6B",
"hgnc_id": 44095,
"effects": [
"non_coding_transcript_exon_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.4_46dupCCCAAGATAGTCCTGAATGGTGTGACCGTAGACTTCCCTTTCC",
"hgvs_p": null
}
],
"clinvar_disease": " 3, Telomere-related, autosomal recessive 5,Dyskeratosis congenita,Pulmonary fibrosis and/or bone marrow failure",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "P:1",
"phenotype_combined": "Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 3;Dyskeratosis congenita, autosomal recessive 5",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}