← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: X-100650812-A-ACAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTAC (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=X&pos=100650812&ref=A&alt=ACAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTAC&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "X",
"pos": 100650812,
"ref": "A",
"alt": "ACAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTAC",
"effect": "intron_variant",
"transcript": "NM_014467.3",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "SRPX2",
"gene_hgnc_id": 30668,
"hgvs_c": "c.112_163+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC",
"hgvs_p": null,
"transcript": "NM_014467.3",
"protein_id": "NP_055282.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 465,
"cds_start": null,
"cds_end": null,
"cds_length": 1398,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "ENST00000373004.5",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_014467.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "SRPX2",
"gene_hgnc_id": 30668,
"hgvs_c": "c.112_163+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC",
"hgvs_p": null,
"transcript": "ENST00000373004.5",
"protein_id": "ENSP00000362095.3",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 465,
"cds_start": null,
"cds_end": null,
"cds_length": 1398,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "NM_014467.3",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000373004.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "SRPX2",
"gene_hgnc_id": 30668,
"hgvs_c": "c.112_163+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC",
"hgvs_p": null,
"transcript": "ENST00000638458.1",
"protein_id": "ENSP00000492168.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 311,
"cds_start": null,
"cds_end": null,
"cds_length": 936,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000638458.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "SRPX2",
"gene_hgnc_id": 30668,
"hgvs_c": "c.112_163+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC",
"hgvs_p": null,
"transcript": "ENST00000640889.1",
"protein_id": "ENSP00000492571.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 222,
"cds_start": null,
"cds_end": null,
"cds_length": 671,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000640889.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SRPX2",
"gene_hgnc_id": 30668,
"hgvs_c": "n.408_469dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC",
"hgvs_p": null,
"transcript": "ENST00000481988.1",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000481988.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "SRPX2",
"gene_hgnc_id": 30668,
"hgvs_c": "n.100_151+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC",
"hgvs_p": null,
"transcript": "ENST00000638319.1",
"protein_id": null,
"transcript_support_level": 4,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000638319.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "SRPX2",
"gene_hgnc_id": 30668,
"hgvs_c": "n.115_166+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC",
"hgvs_p": null,
"transcript": "ENST00000638920.1",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000638920.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "SRPX2",
"gene_hgnc_id": 30668,
"hgvs_c": "n.347_398+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC",
"hgvs_p": null,
"transcript": "ENST00000640020.1",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000640020.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "SRPX2",
"gene_hgnc_id": 30668,
"hgvs_c": "n.46_97+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC",
"hgvs_p": null,
"transcript": "ENST00000677630.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000677630.1"
}
],
"gene_symbol": "SRPX2",
"gene_hgnc_id": 30668,
"dbsnp": "rs2083150642",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 1.594,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 0,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "",
"acmg_by_gene": [
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "NM_014467.3",
"gene_symbol": "SRPX2",
"hgnc_id": 30668,
"effects": [
"intron_variant"
],
"inheritance_mode": "XL,AD",
"hgvs_c": "c.112_163+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC",
"hgvs_p": null
}
],
"clinvar_disease": " X-linked, and speech dyspraxia, intellectual disability,Rolandic epilepsy",
"clinvar_classification": "Uncertain significance",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "US:1",
"phenotype_combined": "Rolandic epilepsy, intellectual disability, and speech dyspraxia, X-linked",
"pathogenicity_classification_combined": "Uncertain significance",
"custom_annotations": null
}
],
"message": null
}