X-100650812-A-ACAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTAC

Variant names:

• chrX-100650812-A-ACAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTAC
• rs2083150642
• NM_014467.3:c.112_163+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_014467.3(SRPX2):​c.112_163+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 22)
• Consequence: SRPX2 NM_014467.3 intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.59

Genes affected

SRPX2 (HGNC:30668): (sushi repeat containing protein X-linked 2) This gene encodes a secreted protein that contains three sushi repeat motifs. The encoded protein may play a role in the development of speech and language centers in the brain. This protein may also be involved in angiogenesis. Mutations in this gene are the cause of bilateral perisylvian polymicrogyria, rolandic epilepsy, speech dyspraxia and cognitive disability. [provided by RefSeq, May 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SRPX2	NM_014467.3	c.112_163+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC		intron_variant	Intron 3 of 10	ENST00000373004.5	NP_055282.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SRPX2	ENST00000373004.5	c.112_163+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC		intron_variant	Intron 3 of 10	1	NM_014467.3	ENSP00000362095.3

Frequencies

GnomAD3 genomes Cov.: 22

GnomAD4 exome Cov.: 29

GnomAD4 genome Cov.: 22

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Rolandic epilepsy, intellectual disability, and speech dyspraxia, X-linked Uncertain:1

Oct 08, 2020

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant has not been reported in the literature in individuals with SRPX2-related conditions. This sequence change falls in intron 3 of the SRPX2 gene. It does not directly change the encoded amino acid sequence of the SRPX2 protein. This variant is not present in population databases (ExAC no frequency). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs2083150642; hg19: chrX-99905809;