ACTB

actin beta, the group of BAF complex|GBAF complex|PBAF complex|Actins

Basic information

Region (hg38): 7:5526408-5563902

Links

ENSG00000075624 ∙ NCBI:60 ∙ OMIM:102630 ∙ HGNC:132 ∙ Uniprot:P60709 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• developmental malformations-deafness-dystonia syndrome (Limited), mode of inheritance: AD
• Baraitser-Winter syndrome 1 (Strong), mode of inheritance: AD
• developmental malformations-deafness-dystonia syndrome (Strong), mode of inheritance: AD
• developmental malformations-deafness-dystonia syndrome (Strong), mode of inheritance: AD
• Baraitser-Winter syndrome 1 (Strong), mode of inheritance: AD
• Baraitser-Winter cerebrofrontofacial syndrome (Supportive), mode of inheritance: AD
• developmental malformations-deafness-dystonia syndrome (Supportive), mode of inheritance: AD
• Baraitser-Winter syndrome 1 (Definitive), mode of inheritance: AD
• Baraitser-Winter syndrome 1 (Strong), mode of inheritance: AD
• developmental malformations-deafness-dystonia syndrome (Strong), mode of inheritance: AD
• ACTB-associated syndromic thrombocytopenia (Moderate), mode of inheritance: AD
• Baraitser-Winter cerebrofrontofacial syndrome (Definitive), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Baraitser-Winter syndrome 1; Dystonia-deafness syndrome 1; Thrombocytopenia 8, with dysmorphic features and developmental delay	AD	Allergy/Immunology/Infectious; Audiologic/Otolaryngologic; Cardiovascular	For individuals with Baraitser-Winter syndrome 1 or Dystonia-deafness syndrome, early recognition and treatment of hearing impairment may improve outcomes, including speech and language development; Individuals with Baraitser-Winter syndrome and Thrombocytopenia 8, with dysmorphic features and developmental delay have been described with congenital heart anomalies, and awareness may enable early diagnosis and management; Thrombocytopenia 8, with dysmorphic features and developmental delay has been described as involving susceptibilty to infections in some individuals, and awareness may allow early and aggressive treatment of infections	Allergy/Immunology/Infectious; Audiologic/Otolaryngologic; Cardiovascular; Craniofacial; Dermatologic; Hematologic; Musculoskeletal; Neurologic; Ophthalmologic; Renal	3351890; 10411937; 12325076; 16685646; 22366783; 23649928; 25052316; 28487785; 30315159; 30921093; 36564926

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the ACTB gene.

• Baraitser-Winter syndrome 1 (323 variants)
• not provided (175 variants)
• Developmental malformations-deafness-dystonia syndrome (28 variants)
• not specified (20 variants)
• Inborn genetic diseases (19 variants)
• Developmental malformations-deafness-dystonia syndrome;Baraitser-Winter syndrome 1 (18 variants)
• Baraitser-Winter syndrome 1;Developmental malformations-deafness-dystonia syndrome (14 variants)
• ACTB-related BAFopathy (9 variants)
• Neurodevelopmental disorder (4 variants)
• ACTB-related condition (4 variants)
• Intellectual disability (3 variants)
• Baraitser-Winter syndrome (3 variants)
• ACTB-related disorders (2 variants)
• Thrombocytopenia (1 variants)
• CONGENITAL SMOOTH MUSCLE HAMARTOMA, SOMATIC, MOSAIC (1 variants)
• Neurodevelopmental delay (1 variants)
• Increased nuchal translucency (1 variants)
• See cases (1 variants)
• Aminoacylase 1 deficiency (1 variants)
• BECKER NEVUS, SOMATIC, MOSAIC (1 variants)
• Microcephaly;Abnormal brain morphology;Short stature (1 variants)
• Thrombocytopenia 8, with dysmorphic features and developmental delay (1 variants)
• BECKER NEVUS SYNDROME, SOMATIC, MOSAIC (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the ACTB gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			6	136	10	152
missense	19	55	75			149
nonsense		1	2			3
start loss			1			1
frameshift	5	4	5			14
inframe indel		3	4			7
splice donor/acceptor (+/-2bp)	1					1
splice region		1	8	18	3	30
non coding			1	58	25	84
Total	25	63	94	194	35

Highest pathogenic variant AF is 0.00000656

Variants in ACTB

This is a list of pathogenic ClinVar variants found in the ACTB region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
7-5527468-C-T			Likely benign (Sep 02, 2019)
7-5527481-C-T			Benign (Aug 15, 2019)
7-5527488-C-T			Likely benign (Sep 02, 2019)
7-5527623-C-A			Benign (Sep 17, 2019)
7-5527623-CA-C			Benign (Aug 10, 2019)
7-5527623-C-CA			Benign (Aug 10, 2019)
7-5527651-C-CA			Likely benign (Aug 06, 2019)
7-5527695-CGCAAGTTAGGTTTTGTCAAGAAAGGGTGTAACGCAACTAAGTCATAGTCCGCCTAGAAGCATTTGCGGTGGACGATGGAGGGGCCGGACTCGTCATACTCCTGCTTGCTGATCCACATCTGCTGGAAGGTGGACAGCGAGGCCAGGATGGAGCCGCCGATCCACACGGAGTACTTGCGCTCAGGAGGAGCAATGATCTGAGGAGGGAAGGGGACAGGCAGTGAGGACCCTGGATGTGACAGCTCCCCACACACCACAGGACCCCACAGCCGACCTGCCCAGGTCAGCTCAGGCAGGAAAGACACCCACCTTGATCTTCATTGTGCTGGGTGCCAGGGCAGTGATCTCCTTCTGCATCCTGTCG-C			Likely pathogenic (Oct 23, 2020)
7-5527751-G-A			Uncertain significance (Mar 20, 2022)
7-5527754-G-A		Baraitser-Winter syndrome 1	Likely benign (Jul 26, 2022)
7-5527755-C-T			Uncertain significance (Mar 23, 2023)
7-5527759-T-A		Baraitser-Winter syndrome 1	Pathogenic (Mar 08, 2018)
7-5527760-G-A			Likely benign (Oct 01, 2023)
7-5527761-C-T		Baraitser-Winter syndrome 1	Uncertain significance (May 19, 2023)
7-5527765-G-A			Uncertain significance (Apr 17, 2019)
7-5527767-A-C		Baraitser-Winter syndrome 1	Uncertain significance (Mar 02, 2023)
7-5527769-G-A		Baraitser-Winter syndrome 1 • Developmental malformations-deafness-dystonia syndrome • Baraitser-Winter syndrome 1;Developmental malformations-deafness-dystonia syndrome	Benign/Likely benign (Jan 30, 2024)
7-5527770-A-ATGGAGGGGCCGGAC			Likely pathogenic (Sep 20, 2016)
7-5527774-A-AG		Thrombocytopenia 8, with dysmorphic features and developmental delay	Pathogenic (Aug 24, 2023)
7-5527775-G-C		Baraitser-Winter syndrome 1	Likely benign (Jan 10, 2024)
7-5527778-G-GC		Baraitser-Winter syndrome 1 • Inborn genetic diseases	Likely pathogenic (Mar 21, 2018)
7-5527781-G-A		Baraitser-Winter syndrome 1	Likely benign (Aug 23, 2022)
7-5527782-G-C		Baraitser-Winter syndrome 1	Uncertain significance (May 21, 2023)
7-5527786-C-T		Baraitser-Winter syndrome 1 • Thrombocytopenia • Thrombocytopenia 8, with dysmorphic features and developmental delay	Conflicting classifications of pathogenicity (Jul 20, 1999)
7-5527787-G-A		Baraitser-Winter syndrome 1 • ACTB-related disorder	Likely benign (Jan 15, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
ACTB	protein_coding	protein_coding	ENST00000331789	5	36634

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.986	0.0144	125685	0	1	125686	0.00000398

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	5.02	14	227	0.0617	0.0000141	2462
Missense in Polyphen		4	121.92	0.03281		1370
Synonymous	-7.44	190	96.9	1.96	0.00000664	751
Loss of Function	3.32	0	12.9	0.00	5.73e-7	146

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00	0.00
Middle Eastern	0.00	0.00
South Asian	0.0000327	0.0000327
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Actin is a highly conserved protein that polymerizes to produce filaments that form cross-linked networks in the cytoplasm of cells (PubMed:29581253). Actin exists in both monomeric (G- actin) and polymeric (F-actin) forms, both forms playing key functions, such as cell motility and contraction (PubMed:29581253). In addition to their role in the cytoplasmic cytoskeleton, G- and F-actin also localize in the nucleus, and regulate gene transcription and motility and repair of damaged DNA (PubMed:29925947). {ECO:0000269|PubMed:29581253, ECO:0000269|PubMed:29925947}.
• Disease: DISEASE: Dystonia, juvenile-onset (DJO) [MIM:607371]: A form of dystonia with juvenile onset. Dystonia is defined by the presence of sustained involuntary muscle contraction, often leading to abnormal postures. Patients with juvenile-onset dystonia manifest progressive, generalized, dopa-unresponsive dystonia, developmental malformations and sensory hearing loss. {ECO:0000269|PubMed:16685646}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Baraitser-Winter syndrome 1 (BRWS1) [MIM:243310]: A rare developmental disorder characterized by the combination of congenital ptosis, high-arched eyebrows, hypertelorism, ocular colobomata, and a brain malformation consisting of anterior- predominant lissencephaly. Other typical features include postnatal short stature and microcephaly, intellectual disability, seizures, and hearing loss. {ECO:0000269|PubMed:22366783}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Platelet activation - Homo sapiens (human);Focal adhesion - Homo sapiens (human);Oxytocin signaling pathway - Homo sapiens (human);Salmonella infection - Homo sapiens (human);Adherens junction - Homo sapiens (human);Dilated cardiomyopathy (DCM) - Homo sapiens (human);Viral myocarditis - Homo sapiens (human);Arrhythmogenic right ventricular cardiomyopathy (ARVC) - Homo sapiens (human);Tight junction - Homo sapiens (human);Influenza A - Homo sapiens (human);Phagosome - Homo sapiens (human);Gastric acid secretion - Homo sapiens (human);Regulation of actin cytoskeleton - Homo sapiens (human);Thermogenesis - Homo sapiens (human);Hypertrophic cardiomyopathy (HCM) - Homo sapiens (human);Hepatocellular carcinoma - Homo sapiens (human);Thyroid hormone signaling pathway - Homo sapiens (human);Hippo signaling pathway - Homo sapiens (human);Fluid shear stress and atherosclerosis - Homo sapiens (human);Vibrio cholerae infection - Homo sapiens (human);Rap1 signaling pathway - Homo sapiens (human);Bacterial invasion of epithelial cells - Homo sapiens (human);Shigellosis - Homo sapiens (human);Pathogenic Escherichia coli infection - Homo sapiens (human);Proteoglycans in cancer - Homo sapiens (human);Apoptosis - Homo sapiens (human);Leukocyte transendothelial migration - Homo sapiens (human);Arrhythmogenic Right Ventricular Cardiomyopathy;Pathogenic Escherichia coli infection;Common Pathways Underlying Drug Addiction;Myometrial Relaxation and Contraction Pathways;Focal Adhesion;Fas Ligand (FasL) pathway and Stress induction of Heat Shock Proteins (HSP) regulation;Regulation of Actin Cytoskeleton;Developmental Biology;B-WICH complex positively regulates rRNA expression;Positive epigenetic regulation of rRNA expression;DNA Repair;Signal Transduction;Epigenetic regulation of gene expression;Gene expression (Transcription);the information processing pathway at the ifn beta enhancer;Post-translational protein modification;Metabolism of proteins;Fcgamma receptor (FCGR) dependent phagocytosis;Chromatin modifying enzymes;EPH-Ephrin signaling;Chaperonin-mediated protein folding;Innate Immune System;Immune System;EPHB-mediated forward signaling;RHO GTPases Activate WASPs and WAVEs;RHO GTPases Activate Formins;HATs acetylate histones;RHO GTPase Effectors;Signaling by Rho GTPases;UCH proteinases;Integrin;EGFR1;Regulation of actin dynamics for phagocytic cup formation;Protein folding;Deubiquitination;Chromatin organization;chromatin remodeling by hswi/snf atp-dependent complexes;Axon guidance;Prefoldin mediated transfer of substrate to CCT/TriC;Folding of actin by CCT/TriC;Cooperation of Prefoldin and TriC/CCT in actin and tubulin folding;DNA Damage Recognition in GG-NER;Global Genome Nucleotide Excision Repair (GG-NER);Nucleotide Excision Repair (Consensus)

Intolerance Scores

• loftool: 0.00310
• rvis_EVS: -0.67
• rvis_percentile_EVS: 15.62

Haploinsufficiency Scores

• pHI: 0.994
• hipred: Y
• hipred_score: 0.771
• ghis: 0.604

Essentials

• essential_gene_CRISPR: E
• essential_gene_CRISPR2: S
• essential_gene_gene_trap: H
• gene_indispensability_pred: E
• gene_indispensability_score: 1.00

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Low	Low	Low
Primary Immunodeficiency	Low	Low	Low
Cancer	Low	Low	Low

Mouse Genome Informatics

• Gene name: Actb
• Phenotype: muscle phenotype; homeostasis/metabolism phenotype; endocrine/exocrine gland phenotype; adipose tissue phenotype (the observable morphological and physiological characteristics of mammalian fat tissue that are manifested through development and lifespan); hematopoietic system phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); growth/size/body region phenotype; reproductive system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); normal phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); hearing/vestibular/ear phenotype; immune system phenotype; liver/biliary system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); embryo phenotype; neoplasm

Gene ontology

• Biological process: regulation of cyclin-dependent protein serine/threonine kinase activity;retina homeostasis;protein deubiquitination;substantia nigra development;regulation of transmembrane transporter activity;negative regulation of protein binding;cell junction assembly;Fc-gamma receptor signaling pathway involved in phagocytosis;ATP-dependent chromatin remodeling;positive regulation of gene expression, epigenetic;ephrin receptor signaling pathway;cell motility;regulation of norepinephrine uptake;positive regulation of norepinephrine uptake;membrane organization;platelet aggregation;cellular response to cytochalasin B;postsynaptic actin cytoskeleton organization;regulation of protein localization to plasma membrane
• Cellular component: nuclear chromatin;extracellular space;nucleus;nucleoplasm;cytoplasm;cytosol;cytoskeleton;plasma membrane;focal adhesion;actin cytoskeleton;membrane;vesicle;protein-containing complex;NuA4 histone acetyltransferase complex;cytoplasmic ribonucleoprotein granule;extracellular exosome;blood microparticle;dense body;presynapse;postsynaptic actin cytoskeleton;glutamatergic synapse;ribonucleoprotein complex
• Molecular function: RNA polymerase II proximal promoter sequence-specific DNA binding;RNA polymerase II distal enhancer sequence-specific DNA binding;structural constituent of cytoskeleton;protein binding;ATP binding;kinesin binding;protein kinase binding;Tat protein binding;nucleosomal DNA binding;identical protein binding;tau protein binding;nitric-oxide synthase binding;structural constituent of postsynaptic actin cytoskeleton