KRT9

keratin 9, the group of Keratins, type I

Basic information

Region (hg38): 17:41565836-41572059

Links

ENSG00000171403 ∙ NCBI:3857 ∙ OMIM:607606 ∙ HGNC:6447 ∙ Uniprot:P35527 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• epidermolytic palmoplantar keratoderma (Strong), mode of inheritance: AD
• epidermolytic palmoplantar keratoderma (Strong), mode of inheritance: AD
• epidermolytic palmoplantar keratoderma (Definitive), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Palmoplantar keratoderma, epidermolytic 1	AD	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Dermatologic	7528239; 7512862; 7511021; 9856842; 12192490; 12838553; 17074468; 19106041

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the KRT9 gene.

• not provided (4 variants)
• Epidermolytic palmoplantar keratoderma, 1 (2 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the KRT9 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			6	16	6	28
missense	3	7	57	7	1	75
nonsense	1					1
start loss						0
frameshift						0
inframe indel			3		2	5
splice donor/acceptor (+/-2bp)			1			1
splice region			1	2	2	5
non coding			15	4	12	31
Total	4	7	82	27	21

Variants in KRT9

This is a list of pathogenic ClinVar variants found in the KRT9 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
17-41565875-G-A		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Jan 15, 2018)
17-41565883-TG-T		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Jun 14, 2016)
17-41565918-T-G		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Jan 13, 2018)
17-41565930-A-G		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Mar 16, 2018)
17-41565963-A-G		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Jan 13, 2018)
17-41565968-A-G		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Jan 12, 2018)
17-41566012-C-T		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Jan 12, 2018)
17-41566070-A-G		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Apr 27, 2017)
17-41566090-G-C		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Jan 13, 2018)
17-41566100-G-A		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Jan 13, 2018)
17-41566160-G-A		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Jan 13, 2018)
17-41567173-CA-C			Benign (May 12, 2021)
17-41567173-C-CA			Benign (May 12, 2021)
17-41567199-A-G			Benign (Nov 12, 2018)
17-41567230-TA-T		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Dec 15, 2018)
17-41567276-G-A		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Jan 13, 2018)
17-41567306-G-A		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Jan 13, 2018)
17-41567338-C-T		Inborn genetic diseases	Uncertain significance (Mar 07, 2024)
17-41567345-G-A		Palmoplantar keratoderma, epidermolytic	Benign/Likely benign (Sep 29, 2022)
17-41567348-G-A		Palmoplantar keratoderma, epidermolytic	Uncertain significance (Jan 13, 2018)
17-41567430-TAGCCACCCCCACTTCCTCCTCCAGAGCCACTTCCTCCTCCATAGTTGCCCCCACTTCCTCCACTATG-T			Uncertain significance (-)
17-41567438-CCCACTTCCTCCTCCAGAGCCACTTCCTCCTCCATAGTTGCCCCCACTTCCTCCACTATGACCACCTCCACTTCCTCCGCTATGGCCACCTCCACTTCCTCCACCATAGCCACCTCCACTACCTCCTCCAGAACCACTTCCTCCACCGTAGCTGCCTCCACTTCCTCCCCTGGACCCACTTCCTCCACCATAGCCACCT-C			Benign (Nov 26, 2023)
17-41567466-C-T			Uncertain significance (Mar 01, 2023)
17-41567471-A-C			Pathogenic (May 03, 2020)
17-41567477-G-T		KRT9-related disorder	Likely benign (Jun 20, 2019)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
KRT9	protein_coding	protein_coding	ENST00000246662	7	6215

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.00000113	0.945	125709	0	39	125748	0.000155

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.199	338	348	0.970	0.0000198	4002
Missense in Polyphen		68	81.977	0.8295		1125
Synonymous	-0.287	134	130	1.03	0.00000762	1252
Loss of Function	1.84	13	22.4	0.580	0.00000113	284

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000420	0.000420
Ashkenazi Jewish	0.0000992	0.0000992
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.000152	0.000149
Middle Eastern	0.00	0.00
South Asian	0.000368	0.000359
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: May serve an important special function either in the mature palmar and plantar skin tissue or in the morphogenetic program of the formation of these tissues. Plays a role in keratin filament assembly. {ECO:0000269|PubMed:10218578, ECO:0000269|PubMed:7507869}.
• Disease: DISEASE: Keratoderma, palmoplantar, epidermolytic (EPPK) [MIM:144200]: A dermatological disorder characterized by diffuse thickening of the epidermis on the entire surface of palms and soles sharply bordered with erythematous margins. Some patients may present knuckle pads, thick pads of skin appearing over the proximal phalangeal joints. {ECO:0000269|PubMed:10632938, ECO:0000269|PubMed:10844507, ECO:0000269|PubMed:12072061, ECO:0000269|PubMed:12192490, ECO:0000269|PubMed:12838553, ECO:0000269|PubMed:12926810, ECO:0000269|PubMed:14675368, ECO:0000269|PubMed:15099359, ECO:0000269|PubMed:15115518, ECO:0000269|PubMed:15605275, ECO:0000269|PubMed:16911293, ECO:0000269|PubMed:16961539, ECO:0000269|PubMed:19874353, ECO:0000269|PubMed:20964665, ECO:0000269|PubMed:21715251, ECO:0000269|PubMed:7511021, ECO:0000269|PubMed:7512862, ECO:0000269|PubMed:7516304, ECO:0000269|PubMed:7523529, ECO:0000269|PubMed:7532199, ECO:0000269|PubMed:8647270, ECO:0000269|PubMed:9204965, ECO:0000269|PubMed:9856842}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Estrogen signaling pathway - Homo sapiens (human);Keratinization;Developmental Biology (Consensus)

Recessive Scores

• pRec: 0.199

Intolerance Scores

• loftool: 0.109
• rvis_EVS: -1.2
• rvis_percentile_EVS: 5.83

Haploinsufficiency Scores

• pHI: 0.166
• hipred: N
• hipred_score: 0.132
• ghis: 0.431

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.533

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Krt9
• Phenotype: homeostasis/metabolism phenotype; cellular phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); limbs/digits/tail phenotype; pigmentation phenotype; neoplasm

Gene ontology

• Biological process: spermatogenesis;epidermis development;keratinization;skin development;intermediate filament organization;cornification
• Cellular component: extracellular space;nucleus;cytosol;intermediate filament;membrane;extracellular exosome
• Molecular function: structural constituent of cytoskeleton