17-41567430-TAGCCACCCCCACTTCCTCCTCCAGAGCCACTTCCTCCTCCATAGTTGCCCCCACTTCCTCCACTATG-T

Position:

• chr17-41567430-TAGCCACCCCCACTTCCTCCTCCAGAGCCACTTCCTCCTCCATAGTTGCCCCCACTTCCTCCACTATG-T

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000226.4(KRT9):​c.1648_1714delCATAGTGGAGGAAGTGGGGGCAACTATGGAGGAGGAAGTGGCTCTGGAGGAGGAAGTGGGGGTGGCT​(p.His550fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 30)
• Consequence: KRT9 NM_000226.4 frameshift
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 1.34

Genes affected

KRT9 (HGNC:6447): (keratin 9) This gene encodes the type I keratin 9, an intermediate filament chain expressed only in the terminally differentiated epidermis of palms and soles. Mutations in this gene cause epidermolytic palmoplantar keratoderma. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
KRT9	NM_000226.4	c.1648_1714delCATAGTGGAGGAAGTGGGGGCAACTATGGAGGAGGAAGTGGCTCTGGAGGAGGAAGTGGGGGTGGCT	p.His550fs	frameshift_variant	7/8	ENST00000246662.9	NP_000217.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
KRT9	ENST00000246662.9	c.1648_1714delCATAGTGGAGGAAGTGGGGGCAACTATGGAGGAGGAAGTGGCTCTGGAGGAGGAAGTGGGGGTGGCT	p.His550fs	frameshift_variant	7/8	1	NM_000226.4	ENSP00000246662.4
KRT9	ENST00000588431.1	c.949_1015delCATAGTGGAGGAAGTGGGGGCAACTATGGAGGAGGAAGTGGCTCTGGAGGAGGAAGTGGGGGTGGCT	p.His317fs	frameshift_variant	8/9	1		ENSP00000467932.1

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, no assertion criteria provided

clinical testing

Department of Pathology and Laboratory Medicine, Sinai Health System

-

The KRT9 p.His550_Gly571del variant was not identified in the literature nor was it identified in dbSNP, ClinVar, LOVD 3.0 or in the following control databases: the 1000 Genomes Project, the NHLBI GO Exome Sequencing Project, the Exome Aggregation Consortium (August 8th 2016), or the Genome Aggregation Database (March 6, 2019, v2.1.1).This variant is an in-frame deletion resulting in the removal of residues 550 to 571; the impact of this alteration on KRT9 protein function is not known. The variant occurs outside of the splicing consensus sequence and two of four in silico or computational prediction software programs (SpliceSiteFinder, MaxEntScan, NNSPLICE, GeneSplicer) predict a 10% difference in splicing. In summary, based on the above information the clinical significance of this variant cannot be determined with certainty at this time. This variant is classified as a variant of uncertain significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-39723682;