17-41567430-TAGCCACCCCCACTTCCTCCTCCAGAGCCACTTCCTCCTCCATAGTTGCCCCCACTTCCTCCACTATG-T

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000226.4(KRT9):​c.1648_1714delCATAGTGGAGGAAGTGGGGGCAACTATGGAGGAGGAAGTGGCTCTGGAGGAGGAAGTGGGGGTGGCT​(p.His550fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (no stars).

Frequency

Genomes: not found (cov: 30)

Consequence

KRT9
NM_000226.4 frameshift

Scores

Not classified

Clinical Significance

Uncertain significance no assertion criteria provided U:1

Conservation

PhyloP100: 1.34
Variant links:
Genes affected
KRT9 (HGNC:6447): (keratin 9) This gene encodes the type I keratin 9, an intermediate filament chain expressed only in the terminally differentiated epidermis of palms and soles. Mutations in this gene cause epidermolytic palmoplantar keratoderma. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
KRT9NM_000226.4 linkuse as main transcriptc.1648_1714delCATAGTGGAGGAAGTGGGGGCAACTATGGAGGAGGAAGTGGCTCTGGAGGAGGAAGTGGGGGTGGCT p.His550fs frameshift_variant 7/8 ENST00000246662.9 NP_000217.2 P35527

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
KRT9ENST00000246662.9 linkuse as main transcriptc.1648_1714delCATAGTGGAGGAAGTGGGGGCAACTATGGAGGAGGAAGTGGCTCTGGAGGAGGAAGTGGGGGTGGCT p.His550fs frameshift_variant 7/81 NM_000226.4 ENSP00000246662.4 P35527
KRT9ENST00000588431.1 linkuse as main transcriptc.949_1015delCATAGTGGAGGAAGTGGGGGCAACTATGGAGGAGGAAGTGGCTCTGGAGGAGGAAGTGGGGGTGGCT p.His317fs frameshift_variant 8/91 ENSP00000467932.1 K7EQQ3

Frequencies

GnomAD3 genomes
Cov.:
30
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
30

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

not provided Uncertain:1
Uncertain significance, no assertion criteria providedclinical testingDepartment of Pathology and Laboratory Medicine, Sinai Health System-The KRT9 p.His550_Gly571del variant was not identified in the literature nor was it identified in dbSNP, ClinVar, LOVD 3.0 or in the following control databases: the 1000 Genomes Project, the NHLBI GO Exome Sequencing Project, the Exome Aggregation Consortium (August 8th 2016), or the Genome Aggregation Database (March 6, 2019, v2.1.1).This variant is an in-frame deletion resulting in the removal of residues 550 to 571; the impact of this alteration on KRT9 protein function is not known. The variant occurs outside of the splicing consensus sequence and two of four in silico or computational prediction software programs (SpliceSiteFinder, MaxEntScan, NNSPLICE, GeneSplicer) predict a 10% difference in splicing. In summary, based on the above information the clinical significance of this variant cannot be determined with certainty at this time. This variant is classified as a variant of uncertain significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-39723682; API