NUS1

NUS1 dehydrodolichyl diphosphate synthase subunit, the group of Dehydrodolichyl diphosphate synthase

Basic information

Region (hg38): 6:117675469-117710727

Previous symbols: [ "C6orf68" ]

Links

ENSG00000153989 ∙ NCBI:116150 ∙ OMIM:610463 ∙ HGNC:21042 ∙ Uniprot:Q96E22 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• congenital disorder of glycosylation, type IAA (Limited), mode of inheritance: AR
• intellectual disability, autosomal dominant 55, with seizures (Moderate), mode of inheritance: AD
• undetermined early-onset epileptic encephalopathy (Supportive), mode of inheritance: AD
• congenital disorder of glycosylation, type IAA (Limited), mode of inheritance: AR
• intellectual disability, autosomal dominant 55, with seizures (Strong), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Intellectual developmental disorder, autosomal dominant, 55, with seizures; Congenital disorder of glycosylation, type 1aa	AD/AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Biochemical; Neurologic; Ophthalmologic	25066056; 29100083

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the NUS1 gene.

• Congenital disorder of glycosylation, type IAA (19 variants)
• Intellectual disability, autosomal dominant 55, with seizures (11 variants)
• not provided (5 variants)
• Inborn genetic diseases (2 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the NUS1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			1	88	2	91
missense	1	3	149	3	1	157
nonsense	14	4				18
start loss		1				1
frameshift	16	7				23
inframe indel			6			6
splice donor/acceptor (+/-2bp)	2	4				6
splice region		1	4	9	1	15
non coding			1	35	8	44
Total	33	19	157	126	11

Variants in NUS1

This is a list of pathogenic ClinVar variants found in the NUS1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
6-117675486-G-A			Likely benign (Sep 23, 2021)
6-117675552-GGCTCGGGGGGCGGGGGGACGCGGAGCGATGGCCCGCGCCGGCCGCAGGGGCGGATAAAAAGCCGTCGCGCTGCGGGAGTGGGCGGGAGGGAGAGGGGGTGTCTGAGGGCCACAAGAGTATGACGGGGCTGTACGAGCTGGTGTGGCGGGTGCTGCACGCGCTGCTCTGTCTGCACCGCACGCTCACCTCCTGGCTCCGCGTTCGGTTCGGCACCTGGAACTGGATCTGGCGGCGCTGCTGCCGCGCCGCCTCTGCCGCGGTCCTAGCGCCGCTCGGC-G		Congenital disorder of glycosylation, type IAA	Likely pathogenic (Mar 08, 2023)
6-117675655-T-C		Intellectual disability, autosomal dominant 55, with seizures • Congenital disorder of glycosylation, type IAA	Benign (Sep 05, 2021)
6-117675667-G-T			Uncertain significance (Mar 01, 2022)
6-117675673-G-A		Congenital disorder of glycosylation, type IAA • NUS1-related disorder	Uncertain significance (Oct 28, 2022)
6-117675674-AC-A			Pathogenic (May 27, 2022)
6-117675675-C-CG			Likely pathogenic (Mar 14, 2022)
6-117675676-G-C		Congenital disorder of glycosylation, type IAA	Likely benign (Nov 27, 2023)
6-117675677-G-A		Congenital disorder of glycosylation, type IAA	Uncertain significance (Oct 10, 2021)
6-117675683-TACGAGCTGGTGTGGCGGGTGCTGC-T		Congenital disorder of glycosylation, type IAA	Uncertain significance (Nov 24, 2022)
6-117675685-C-A		Congenital disorder of glycosylation, type IAA	Pathogenic (Dec 30, 2021)
6-117675686-G-C		Intellectual disability, autosomal dominant 55, with seizures • Congenital disorder of glycosylation, type IAA	Uncertain significance (Sep 23, 2023)
6-117675687-AGCTGGTGTGGCGGGTGCTGCACGC-A			Uncertain significance (Apr 10, 2019)
6-117675688-G-T		Congenital disorder of glycosylation, type IAA	Uncertain significance (Jan 20, 2023)
6-117675689-C-G		NUS1-related disorder	Uncertain significance (Jan 30, 2023)
6-117675691-GGT-G			Pathogenic (-)
6-117675692-G-T		Congenital disorder of glycosylation, type IAA	Uncertain significance (Dec 04, 2023)
6-117675693-T-C			Uncertain significance (Jan 24, 2022)
6-117675694-G-A		Congenital disorder of glycosylation, type IAA	Likely benign (Nov 27, 2023)
6-117675694-G-T		Congenital disorder of glycosylation, type IAA	Likely benign (Dec 08, 2023)
6-117675696-G-A		Intellectual disability, autosomal dominant 55, with seizures	Likely pathogenic (Oct 01, 2024)
6-117675697-G-T		Inborn genetic diseases	Uncertain significance (Apr 20, 2021)
6-117675696-G-GGC			Likely pathogenic (Oct 23, 2020)
6-117675698-C-G		Inborn genetic diseases	Uncertain significance (Feb 27, 2023)
6-117675698-C-T		Congenital disorder of glycosylation, type IAA • Inborn genetic diseases	Uncertain significance (Mar 18, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
NUS1	protein_coding	protein_coding	ENST00000368494	5	35139

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.981	0.0188	0	0	0	0	0.00

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.876	126	157	0.803	0.00000760	1875
Missense in Polyphen		14	35.938	0.38956		427
Synonymous	-0.136	67	65.6	1.02	0.00000319	577
Loss of Function	3.23	0	12.1	0.00	5.13e-7	150

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00	0.00
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: With DHDDS, forms the dehydrodolichyl diphosphate synthase (DDS) complex, an essential component of the dolichol monophosphate (Dol-P) biosynthetic machinery. Both subunits contribute to enzymatic activity, i.e. condensation of multiple copies of isopentenyl pyrophosphate (IPP) to farnesyl pyrophosphate (FPP) to produce dehydrodolichyl diphosphate (Dedol- PP), a precursor of dolichol phosphate which is utilized as a sugar carrier in protein glycosylation in the endoplasmic reticulum (ER) (PubMed:21572394, PubMed:25066056, PubMed:28842490). Regulates the glycosylation and stability of nascent NPC2, thereby promoting trafficking of LDL-derived cholesterol. Acts as a specific receptor for the N-terminus of Nogo-B, a neural and cardiovascular regulator (PubMed:16835300). {ECO:0000269|PubMed:16835300, ECO:0000269|PubMed:21572394, ECO:0000269|PubMed:25066056, ECO:0000269|PubMed:28842490}.
• Disease: DISEASE: Congenital disorder of glycosylation 1AA (CDG1AA) [MIM:617082]: A form of congenital disorder of glycosylation, a multisystem disorder caused by a defect in glycoprotein biosynthesis and characterized by under-glycosylated serum glycoproteins. Congenital disorders of glycosylation result in a wide variety of clinical features, such as defects in the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. CDG1AA inheritance is autosomal recessive. {ECO:0000269|PubMed:25066056}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Mental retardation, autosomal dominant 55, with seizures (MRD55) [MIM:617831]: A form of mental retardation, a disorder characterized by significantly below average general intellectual functioning associated with impairments in adaptive behavior and manifested during the developmental period. MRD55 patients suffer from seizures appearing during the first years of life. {ECO:0000269|PubMed:29100083}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Terpenoid backbone biosynthesis - Homo sapiens (human);Post-translational protein modification;Metabolism of proteins;Synthesis of Dolichyl-phosphate;Synthesis of substrates in N-glycan biosythesis;Biosynthesis of the N-glycan precursor (dolichol lipid-linked oligosaccharide, LLO) and transfer to a nascent protein;Asparagine N-linked glycosylation (Consensus)

Recessive Scores

• pRec: 0.120

Haploinsufficiency Scores

• pHI: 0.519
• hipred: Y
• hipred_score: 0.673
• ghis: 0.629

Essentials

• essential_gene_CRISPR: E
• essential_gene_gene_trap: E
• gene_indispensability_pred: N
• gene_indispensability_score: 0.160

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Nus1
• Phenotype: mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); liver/biliary system phenotype; cellular phenotype; homeostasis/metabolism phenotype

Zebrafish Information Network

• Gene name: nus1
• Affected structure: intersegmental vessel
• Phenotype tag: abnormal
• Phenotype quality: decreased amount

Gene ontology

• Biological process: angiogenesis;dolichyl diphosphate biosynthetic process;dolichol biosynthetic process;cell differentiation;regulation of intracellular cholesterol transport;protein mannosylation;vascular endothelial growth factor signaling pathway;cholesterol homeostasis;positive regulation of blood vessel endothelial cell migration;positive regulation of nitric-oxide synthase activity
• Cellular component: endoplasmic reticulum membrane;integral component of membrane;dehydrodolichyl diphosphate synthase complex
• Molecular function: prenyltransferase activity;protein binding;dehydrodolichyl diphosphate synthase activity