6-117675683-TACGAGCTGGTGTGGCGGGTGCTGC-T

Variant names:

• chr6-117675683-TACGAGCTGGTGTGGCGGGTGCTGC-T
• NM_138459.5:c.17_40delAGCTGGTGTGGCGGGTGCTGCACG

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4

The NM_138459.5(NUS1):​c.17_40delAGCTGGTGTGGCGGGTGCTGCACG​(p.Glu6_His13del) variant causes a disruptive inframe deletion change. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.0 (0 hom., cov: 31)
  • Failed GnomAD Quality Control
• Consequence: NUS1 NM_138459.5 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.34

Genes affected

NUS1 (HGNC:21042): (NUS1 dehydrodolichyl diphosphate synthase subunit) This gene encodes a type I single transmembrane domain receptor, which is a subunit of cis-prenyltransferase, and serves as a specific receptor for the neural and cardiovascular regulator Nogo-B. The encoded protein is essential for dolichol synthesis and protein glycosylation. This gene is highly expressed in non-small cell lung carcinomas as well as estrogen receptor-alpha positive breast cancer cells where it promotes epithelial mesenchymal transition. This gene is associated with the poor prognosis of human hepatocellular carcinoma patients. Naturally occurring mutations in this gene cause a congenital disorder of glycosylation and are associated with epilepsy. A knockout of the orthologous gene in mice causes embryonic lethality before day 6.5. Pseudogenes of this gene have been defined on chromosomes 13 and X. [provided by RefSeq, May 2017]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_138459.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NUS1	NM_138459.5	c.17_40delAGCTGGTGTGGCGGGTGCTGCACG	p.Glu6_His13del	disruptive_inframe_deletion	Exon 1 of 5	ENST00000368494.4	NP_612468.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NUS1	ENST00000368494.4	c.17_40delAGCTGGTGTGGCGGGTGCTGCACG	p.Glu6_His13del	disruptive_inframe_deletion	Exon 1 of 5	1	NM_138459.5	ENSP00000357480.3

Frequencies

GnomAD3 genomes AF: 0.00 AC: 0 AN: 151370 Hom.: 0 Cov.: 31 FAILED QC

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 151370 Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0 AN XY: 73874

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Congenital disorder of glycosylation, type IAA Uncertain:1

Nov 24, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with NUS1-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.17_40del, results in the deletion of 8 amino acid(s) of the NUS1 protein (p.Glu6_His13del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr6-117996846;