TERT

telomerase reverse transcriptase

Basic information

Region (hg38): 5:1253146-1295068

Links

ENSG00000164362 ∙ ∙ OMIM:187270 ∙ HGNC:11730 ∙ Uniprot:O14746 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• acute myeloid leukemia (Strong), mode of inheritance: AD
• dyskeratosis congenita, autosomal dominant 2 (Moderate), mode of inheritance: AD
• dyskeratosis congenita, autosomal dominant 2 (Moderate), mode of inheritance: AR
• dyskeratosis congenita, autosomal dominant 2 (Definitive), mode of inheritance: Semidominant
• melanoma, cutaneous malignant, susceptibility to, 9 (Limited), mode of inheritance: AD
• pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 (Definitive), mode of inheritance: AD
• dyskeratosis congenita, autosomal dominant 2 (Definitive), mode of inheritance: Unknown
• dyskeratosis congenita (Supportive), mode of inheritance: AD
• Hoyeraal-Hreidarsson syndrome (Supportive), mode of inheritance: AD
• acute myeloid leukemia (Limited), mode of inheritance: AD
• dyskeratosis congenita, autosomal dominant 2 (Strong), mode of inheritance: AD
• dyskeratosis congenita, autosomal dominant 2 (Strong), mode of inheritance: AR
• pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 (Strong), mode of inheritance: AD
• melanoma, cutaneous malignant, susceptibility to, 9 (Limited), mode of inheritance: AD
• dyskeratosis congenita, autosomal dominant 2 (Definitive), mode of inheritance: AR
• dyskeratosis congenita, autosomal dominant 2 (Definitive), mode of inheritance: Semidominant

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Aplastic anemia; Dyskeratosis congenita, autosomal dominant 2; Dyskeratosis congenita, autosomal recessive 4; Pulmonary fibrosis and/or bone marrow failure, telomere-related 1	AD/AR	Allergy/Immunology/Infectious; Hematologic; Oncologic; Pulmonary	In dyskeratosis congenita, the presentation many not always be classic, and individuals are at high risk for hematologic anomalies (including bone marrow failure) and malignancy, and surveillance and prompt diagnosis and treatment may be beneficial; In Aplastic anemia, surveillance and prompt treatment of aplastic anemia and bone marrow failure may reduce morbidity; HSCT may be effective; For treatment related to pulmonary fibrosis, immunotherapy may be beneficial, though lung transplantation may be indicated in individuals with severe/refractory disease	Allergy/Immunology/Infectious; Cardiovascular; Dental; Dermatologic; Endocrine; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Oncologic; Pulmonary	16247010; 15814878; 16890917; 17392301; 17785587; 17460043; 18460650; 18042801; 19760749; 21602826; 20502709; 21436073; 22512499; 20301779

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the TERT gene.

• Dyskeratosis congenita, autosomal dominant 2;Idiopathic Pulmonary Fibrosis (1205 variants)
• Idiopathic Pulmonary Fibrosis;Dyskeratosis congenita, autosomal dominant 2 (847 variants)
• Hereditary cancer-predisposing syndrome;Dyskeratosis congenita (571 variants)
• Dyskeratosis congenita;Hereditary cancer-predisposing syndrome (441 variants)
• not provided (296 variants)
• Dyskeratosis congenita, autosomal dominant 2 (167 variants)
• not specified (156 variants)
• Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 (107 variants)
• Aplastic anemia (79 variants)
• Dyskeratosis congenita (69 variants)
• Pulmonary fibrosis (39 variants)
• Interstitial lung disease 2;Dyskeratosis congenita, autosomal dominant 2 (37 variants)
• 7 conditions (28 variants)
• Acute myeloid leukemia (25 variants)
• TERT-related condition (24 variants)
• Interstitial lung disease 2 (17 variants)
• Dyskeratosis congenita, autosomal dominant 2;Interstitial lung disease 2 (16 variants)
• Dyskeratosis congenita, autosomal dominant 1 (11 variants)
• Autosomal recessive dyskeratosis congenita 4 (5 variants)
• Inborn genetic diseases (5 variants)
• Telomere syndrome (4 variants)
• Chronic osteomyelitis (2 variants)
• Dyskeratosis congenita, autosomal dominant 2;Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1;Melanoma, cutaneous malignant, susceptibility to, 9;Acute myeloid leukemia (2 variants)
• Melanoma, cutaneous malignant, susceptibility to, 9 (2 variants)
• Hereditary cancer-predisposing syndrome (2 variants)
• Hepatocellular carcinoma (2 variants)
• Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1;Dyskeratosis congenita, autosomal dominant 2 (2 variants)
• Dyskeratosis congenita, autosomal recessive 1 (2 variants)
• Myelodysplasia (1 variants)
• Short telomere length;Abnormal pulmonary interstitial morphology;Macrocytic anemia;Premature graying of hair (1 variants)
• Malignant tumor of urinary bladder (1 variants)
• Breast carcinoma (1 variants)
• Acute myeloid leukemia;Melanoma, cutaneous malignant, susceptibility to, 9;Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1;Dyskeratosis congenita, autosomal dominant 2 (1 variants)
• Chronic obstructive pulmonary disease (1 variants)
• Dyskeratosis congenita, autosomal dominant 2;Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 (1 variants)
• Hereditary breast ovarian cancer syndrome (1 variants)
• Dyskeratosis Congenita, Recessive (1 variants)
• Autosomal recessive dyskeratosis congenita 4;Hoyeraal-Hreidarsson syndrome (1 variants)
• Chronic diarrhea;Decreased circulating antibody level;Immunodeficiency;Chronic obstructive pulmonary disease (1 variants)
• Inherited Immunodeficiency Diseases (1 variants)
• Malignant tumor of breast (1 variants)
• Combined pulmonary fibrosis-emphysema syndrome (1 variants)
• Acute myeloid leukemia;Dyskeratosis congenita, autosomal dominant 2;Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1;Melanoma, cutaneous malignant, susceptibility to, 9 (1 variants)
• Leukemia, acute myeloid, susceptibility to (1 variants)
• Abnormal pulmonary interstitial morphology (1 variants)
• Hepatoblastoma (1 variants)
• Acute myeloid leukemia;Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1;Melanoma, cutaneous malignant, susceptibility to, 9;Dyskeratosis congenita, autosomal dominant 2 (1 variants)
• TERT-associated disorder (1 variants)
• TERT-Related Disorders (1 variants)
• Short telomere length;Abnormal pulmonary interstitial morphology (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the TERT gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			11	843	6	860
missense	2	21	996	27	3	1049
nonsense	18		1			19
start loss						0
frameshift	31	3	2			36
inframe indel			6			6
splice donor/acceptor (+/-2bp)		13	2			15
splice region			54	81	2	137
non coding			19	217	42	278
Total	51	37	1037	1087	51

Highest pathogenic variant AF is 0.0000854

Variants in TERT

This is a list of pathogenic ClinVar variants found in the TERT region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
5-1253389-A-G		Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Dyskeratosis congenita, autosomal dominant 2 • Aplastic anemia	Uncertain significance (Jan 12, 2018)
5-1253420-T-C		Dyskeratosis congenita, autosomal dominant 2 • Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Aplastic anemia	Uncertain significance (Jan 12, 2018)
5-1253491-G-A		Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Aplastic anemia • Dyskeratosis congenita, autosomal dominant 2	Uncertain significance (Jan 13, 2018)
5-1253498-A-G		Dyskeratosis congenita, autosomal dominant 2 • Aplastic anemia • Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1	Uncertain significance (Jan 12, 2018)
5-1253545-AGGCCTCAGCCGGACACTCAGCCTTCAGCCGGACATGCAGGCCTCGGCCAAACACTCACTCAGGCCTCAGACTCCCAGCGGTGCGGGCCTGGGTGTGGGCCGCCCCTCCCTCCCTGGGACGTAGAGCCCGGCGTGACAGGGCTGCTGGTGTCTGCTCTCGGCCTGGCTGTGGGCGGGT-A		Interstitial lung disease 2	Pathogenic (May 10, 2012)
5-1253575-G-A		Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Dyskeratosis congenita, autosomal dominant 2 • Aplastic anemia	Benign (Jan 13, 2018)
5-1253624-G-A		Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Aplastic anemia • Dyskeratosis congenita, autosomal dominant 2	Uncertain significance (Jan 13, 2018)
5-1253629-G-A		Dyskeratosis congenita, autosomal dominant 2 • Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Aplastic anemia • not specified	Benign (Jan 24, 2024)
5-1253645-C-T		Dyskeratosis congenita, autosomal dominant 2 • Aplastic anemia • Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1	Uncertain significance (Jan 17, 2018)
5-1253664-C-T		Dyskeratosis congenita, autosomal dominant 2 • Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Aplastic anemia	Uncertain significance (Jan 13, 2018)
5-1253665-G-A		Dyskeratosis congenita, autosomal dominant 2 • Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Aplastic anemia	Benign/Likely benign (Feb 14, 2019)
5-1253718-C-T		TERT-related disorder	Likely benign (May 04, 2022)
5-1253728-T-C		Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1	Likely pathogenic (Nov 23, 2017)
5-1253736-G-A		Idiopathic Pulmonary Fibrosis;Dyskeratosis congenita, autosomal dominant 2	Likely benign (Feb 01, 2023)
5-1253741-G-C		Dyskeratosis congenita;Hereditary cancer-predisposing syndrome • Dyskeratosis congenita, autosomal dominant 2;Idiopathic Pulmonary Fibrosis	Uncertain significance (Jul 07, 2023)
5-1253741-G-T		Idiopathic Pulmonary Fibrosis;Dyskeratosis congenita, autosomal dominant 2	Uncertain significance (Dec 12, 2020)
5-1253746-G-A		Idiopathic Pulmonary Fibrosis;Dyskeratosis congenita, autosomal dominant 2	Likely benign (Oct 08, 2021)
5-1253749-G-A		Idiopathic Pulmonary Fibrosis;Dyskeratosis congenita, autosomal dominant 2	Likely benign (Jan 12, 2024)
5-1253752-T-C		Dyskeratosis congenita;Hereditary cancer-predisposing syndrome	Likely benign (Jun 20, 2021)
5-1253754-A-C		Dyskeratosis congenita;Hereditary cancer-predisposing syndrome • Idiopathic Pulmonary Fibrosis;Dyskeratosis congenita, autosomal dominant 2	Conflicting classifications of pathogenicity (Oct 27, 2022)
5-1253755-G-C		Hereditary cancer-predisposing syndrome;Dyskeratosis congenita • Idiopathic Pulmonary Fibrosis;Dyskeratosis congenita, autosomal dominant 2	Likely benign (Apr 18, 2023)
5-1253756-G-A		Dyskeratosis congenita, autosomal dominant 2;Idiopathic Pulmonary Fibrosis	Uncertain significance (Mar 13, 2021)
5-1253758-C-T		Dyskeratosis congenita;Hereditary cancer-predisposing syndrome • Dyskeratosis congenita, autosomal dominant 2;Idiopathic Pulmonary Fibrosis	Likely benign (Jan 24, 2024)
5-1253760-G-C		Dyskeratosis congenita, autosomal dominant 2;Idiopathic Pulmonary Fibrosis	Uncertain significance (Feb 27, 2020)
5-1253764-C-T		Dyskeratosis congenita • Dyskeratosis congenita;Hereditary cancer-predisposing syndrome • Dyskeratosis congenita, autosomal dominant 2;Idiopathic Pulmonary Fibrosis	Likely benign (Jan 20, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
TERT	protein_coding	protein_coding	ENST00000310581	16	41923

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.990	0.00954	125724	0	23	125747	0.0000915

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	4.88	350	718	0.488	0.0000537	7124
Missense in Polyphen		45	208.81	0.2155		2420
Synonymous	0.251	330	336	0.983	0.0000264	2503
Loss of Function	5.24	7	44.8	0.156	0.00000232	457

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0000290	0.0000290
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.000608	0.000601
European (Non-Finnish)	0.0000565	0.0000527
Middle Eastern	0.00	0.00
South Asian	0.0000653	0.0000653
Other	0.000167	0.000163

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Telomerase is a ribonucleoprotein enzyme essential for the replication of chromosome termini in most eukaryotes. Active in progenitor and cancer cells. Inactive, or very low activity, in normal somatic cells. Catalytic component of the teleromerase holoenzyme complex whose main activity is the elongation of telomeres by acting as a reverse transcriptase that adds simple sequence repeats to chromosome ends by copying a template sequence within the RNA component of the enzyme. Catalyzes the RNA- dependent extension of 3'-chromosomal termini with the 6- nucleotide telomeric repeat unit, 5'-TTAGGG-3'. The catalytic cycle involves primer binding, primer extension and release of product once the template boundary has been reached or nascent product translocation followed by further extension. More active on substrates containing 2 or 3 telomeric repeats. Telomerase activity is regulated by a number of factors including telomerase complex-associated proteins, chaperones and polypeptide modifiers. Modulates Wnt signaling. Plays important roles in aging and antiapoptosis. {ECO:0000269|PubMed:14963003, ECO:0000269|PubMed:15082768, ECO:0000269|PubMed:15857955, ECO:0000269|PubMed:17026956, ECO:0000269|PubMed:17264120, ECO:0000269|PubMed:17296728, ECO:0000269|PubMed:17548608, ECO:0000269|PubMed:19188162, ECO:0000269|PubMed:19567472, ECO:0000269|PubMed:19571879, ECO:0000269|PubMed:19777057, ECO:0000269|PubMed:9389643}.
• Disease: DISEASE: Note=Activation of telomerase has been implicated in cell immortalization and cancer cell pathogenesis.; DISEASE: Aplastic anemia (AA) [MIM:609135]: A form of anemia in which the bone marrow fails to produce adequate numbers of peripheral blood elements. It is characterized by peripheral pancytopenia and marrow hypoplasia. {ECO:0000269|PubMed:15885610, ECO:0000269|PubMed:16627250, ECO:0000269|PubMed:16990594, ECO:0000269|PubMed:19760749}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.; DISEASE: Note=Genetic variations in TERT are associated with coronary artery disease (CAD).; DISEASE: Dyskeratosis congenita, autosomal dominant, 2 (DKCA2) [MIM:613989]: A rare multisystem disorder caused by defective telomere maintenance. It is characterized by progressive bone marrow failure, and the clinical triad of reticulated skin hyperpigmentation, nail dystrophy, and mucosal leukoplakia. Common but variable features include premature graying, aplastic anemia, low platelets, osteoporosis, pulmonary fibrosis, and liver fibrosis among others. Early mortality is often associated with bone marrow failure, infections, fatal pulmonary complications, or malignancy. {ECO:0000269|PubMed:15885610, ECO:0000269|PubMed:16247010, ECO:0000269|PubMed:21602826}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Pulmonary fibrosis, and/or bone marrow failure, telomere- related, 1 (PFBMFT1) [MIM:614742]: A disease associated with shortened telomeres. Pulmonary fibrosis is the most common manifestation. Other manifestations include aplastic anemia due to bone marrow failure, hepatic fibrosis, and increased cancer risk, particularly myelodysplastic syndrome and acute myeloid leukemia. Phenotype, age at onset, and severity are determined by telomere length. {ECO:0000269|PubMed:15814878, ECO:0000269|PubMed:17460043, ECO:0000269|PubMed:21436073, ECO:0000269|PubMed:21483807, ECO:0000269|PubMed:22512499}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Dyskeratosis congenita, autosomal recessive, 4 (DKCB4) [MIM:613989]: A severe form of dyskeratosis congenita, a rare multisystem disorder caused by defective telomere maintenance. It is characterized by progressive bone marrow failure, and the clinical triad of reticulated skin hyperpigmentation, nail dystrophy, and mucosal leukoplakia. Common but variable features include premature graying, aplastic anemia, low platelets, osteoporosis, pulmonary fibrosis, and liver fibrosis among others. Early mortality is often associated with bone marrow failure, infections, fatal pulmonary complications, or malignancy. {ECO:0000269|PubMed:16332973, ECO:0000269|PubMed:17785587, ECO:0000269|PubMed:18042801, ECO:0000269|PubMed:21602826}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Pulmonary fibrosis, idiopathic (IPF) [MIM:178500]: A lung disease characterized by shortness of breath, radiographically evident diffuse pulmonary infiltrates, and varying degrees of inflammation and fibrosis on biopsy. In some cases, the disorder can be rapidly progressive and characterized by sequential acute lung injury with subsequent scarring and end-stage lung disease. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.; DISEASE: Melanoma, cutaneous malignant 9 (CMM9) [MIM:615134]: A malignant neoplasm of melanocytes, arising de novo or from a pre- existing benign nevus, which occurs most often in the skin but also may involve other sites. {ECO:0000269|PubMed:23348503}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.
• Pathway: Gastric cancer - Homo sapiens (human);HTLV-I infection - Homo sapiens (human);Hepatocellular carcinoma - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);Human papillomavirus infection - Homo sapiens (human);miR-targeted genes in epithelium - TarBase;miR-targeted genes in lymphocytes - TarBase;Lung fibrosis;TGF-beta Signaling Pathway;Signaling by WNT;Signal Transduction;telomeres telomerase cellular aging and immortality;overview of telomerase protein component gene htert transcriptional regulation;erk1/erk2 mapk signaling pathway;Telomere Extension By Telomerase;Extension of Telomeres;Telomere Maintenance;Chromosome Maintenance;role of nicotinic acetylcholine receptors in the regulation of apoptosis;IL2;Cell Cycle;Regulation of nuclear beta catenin signaling and target gene transcription;Validated targets of C-MYC transcriptional activation;Regulation of Telomerase;IL2 signaling events mediated by PI3K;Formation of the beta-catenin:TCF transactivating complex;TCF dependent signaling in response to WNT;HIF-1-alpha transcription factor network (Consensus)

Recessive Scores

• pRec: 0.675

Haploinsufficiency Scores

• pHI: 0.229
• hipred: Y
• hipred_score: 0.693
• ghis: 0.432

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.287

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Tert
• Phenotype: neoplasm; hematopoietic system phenotype; reproductive system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); normal phenotype; respiratory system phenotype; skeleton phenotype; immune system phenotype; digestive/alimentary phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); taste/olfaction phenotype; endocrine/exocrine gland phenotype; growth/size/body region phenotype; homeostasis/metabolism phenotype; cellular phenotype

Zebrafish Information Network

• Gene name: tert
• Affected structure: nucleate erythrocyte
• Phenotype tag: abnormal
• Phenotype quality: decreased amount

Gene ontology

• Biological process: telomere maintenance;transcription, RNA-templated;RNA-dependent DNA biosynthetic process;telomere maintenance via telomerase;mitochondrion organization;negative regulation of gene expression;DNA strand elongation;positive regulation of Wnt signaling pathway;production of siRNA involved in RNA interference;regulation of protein stability;positive regulation of protein binding;RNA biosynthetic process;positive regulation of hair cycle;negative regulation of neuron apoptotic process;positive regulation of angiogenesis;positive regulation of glucose import;response to cadmium ion;positive regulation of nitric-oxide synthase activity;negative regulation of glial cell proliferation;establishment of protein localization to telomere;cellular response to hypoxia;DNA biosynthetic process;replicative senescence;positive regulation of G1/S transition of mitotic cell cycle;positive regulation of pri-miRNA transcription by RNA polymerase II;positive regulation of transdifferentiation;negative regulation of production of siRNA involved in RNA interference;positive regulation of vascular smooth muscle cell proliferation;positive regulation of protein localization to nucleolus;positive regulation of vascular associated smooth muscle cell migration;beta-catenin-TCF complex assembly;negative regulation of endothelial cell apoptotic process;positive regulation of stem cell proliferation;negative regulation of cellular senescence;negative regulation of extrinsic apoptotic signaling pathway in absence of ligand
• Cellular component: telomerase catalytic core complex;chromosome, telomeric region;nuclear telomere cap complex;nuclear chromosome, telomeric region;nucleus;nucleoplasm;telomerase holoenzyme complex;nucleolus;cytosol;plasma membrane;PML body;nuclear speck;RNA-directed RNA polymerase complex;mitochondrial nucleoid;TERT-RMRP complex
• Molecular function: tRNA binding;transcription coactivator binding;DNA binding;telomerase activity;telomerase RNA reverse transcriptase activity;RNA binding;RNA-directed DNA polymerase activity;RNA-directed 5'-3' RNA polymerase activity;protein binding;protein C-terminus binding;nucleotidyltransferase activity;telomeric DNA binding;identical protein binding;protein homodimerization activity;metal ion binding;protein N-terminus binding;chaperone binding;telomerase RNA binding;template-free RNA nucleotidyltransferase