TERT
telomerase reverse transcriptase
Basic information
Region (hg38): 5:1253147-1295068
Links
Phenotypes
GenCC
Source:
- acute myeloid leukemia (Strong), mode of inheritance: AD
- dyskeratosis congenita, autosomal dominant 2 (Moderate), mode of inheritance: AD
- dyskeratosis congenita, autosomal dominant 2 (Moderate), mode of inheritance: AR
- dyskeratosis congenita, autosomal dominant 2 (Definitive), mode of inheritance: Semidominant
- melanoma, cutaneous malignant, susceptibility to, 9 (Limited), mode of inheritance: AD
- pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 (Definitive), mode of inheritance: AD
- dyskeratosis congenita, autosomal dominant 2 (Definitive), mode of inheritance: Unknown
- dyskeratosis congenita (Supportive), mode of inheritance: AD
- Hoyeraal-Hreidarsson syndrome (Supportive), mode of inheritance: AD
- acute myeloid leukemia (Limited), mode of inheritance: AD
- dyskeratosis congenita, autosomal dominant 2 (Strong), mode of inheritance: AD
- dyskeratosis congenita, autosomal dominant 2 (Strong), mode of inheritance: AR
- pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 (Strong), mode of inheritance: AD
- melanoma, cutaneous malignant, susceptibility to, 9 (Limited), mode of inheritance: AD
- dyskeratosis congenita, autosomal dominant 2 (Definitive), mode of inheritance: AR
- dyskeratosis congenita, autosomal dominant 2 (Definitive), mode of inheritance: Semidominant
Clinical Genomic Database
Source:
| Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
|---|---|---|---|---|---|
| Aplastic anemia; Dyskeratosis congenita, autosomal dominant 2; Dyskeratosis congenita, autosomal recessive 4; Pulmonary fibrosis and/or bone marrow failure, telomere-related 1 | AD/AR | Allergy/Immunology/Infectious; Hematologic; Oncologic; Pulmonary | In dyskeratosis congenita, the presentation many not always be classic, and individuals are at high risk for hematologic anomalies (including bone marrow failure) and malignancy, and surveillance and prompt diagnosis and treatment may be beneficial; In Aplastic anemia, surveillance and prompt treatment of aplastic anemia and bone marrow failure may reduce morbidity; HSCT may be effective; For treatment related to pulmonary fibrosis, immunotherapy may be beneficial, though lung transplantation may be indicated in individuals with severe/refractory disease | Allergy/Immunology/Infectious; Cardiovascular; Dental; Dermatologic; Endocrine; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Oncologic; Pulmonary | 16247010; 15814878; 16890917; 17392301; 17785587; 17460043; 18460650; 18042801; 19760749; 21602826; 20502709; 21436073; 22512499; 20301779 |
ClinVar
This is a list of variants' phenotypes submitted to
- Dyskeratosis congenita, autosomal dominant 2;Idiopathic Pulmonary Fibrosis (35 variants)
- Idiopathic Pulmonary Fibrosis;Dyskeratosis congenita, autosomal dominant 2 (31 variants)
- Dyskeratosis congenita, autosomal dominant 2 (4 variants)
- Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 (4 variants)
- Pulmonary fibrosis (3 variants)
- not provided (3 variants)
- Interstitial lung disease 2 (2 variants)
- Dyskeratosis congenita, autosomal dominant 2;Interstitial lung disease 2 (1 variants)
- Dyskeratosis congenita (1 variants)
- Telomere syndrome (1 variants)
- TERT-related disorder (1 variants)
- Inherited Immunodeficiency Diseases (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the TERT gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 12 | 1010 | 1028 | |||
| missense | 25 | 1250 | 28 | 1308 | ||
| nonsense | 24 | 26 | ||||
| start loss | 0 | |||||
| frameshift | 46 | 52 | ||||
| inframe indel | 7 | |||||
| splice donor/acceptor (+/-2bp) | 22 | 24 | ||||
| splice region | 54 | 103 | 3 | 160 | ||
| non coding | 21 | 292 | 43 | 356 | ||
| Total | 74 | 51 | 1295 | 1330 | 51 |
Highest pathogenic variant AF is 0.0000854
Variants in TERT
This is a list of pathogenic ClinVar variants found in the TERT region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| 5-1253389-A-G | Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Dyskeratosis congenita, autosomal dominant 2 • Aplastic anemia | Uncertain significance (Jan 12, 2018) | ||
| 5-1253420-T-C | Dyskeratosis congenita, autosomal dominant 2 • Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Aplastic anemia | Uncertain significance (Jan 12, 2018) | ||
| 5-1253491-G-A | Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Aplastic anemia • Dyskeratosis congenita, autosomal dominant 2 | Uncertain significance (Jan 13, 2018) | ||
| 5-1253498-A-G | Dyskeratosis congenita, autosomal dominant 2 • Aplastic anemia • Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 | Uncertain significance (Jan 12, 2018) | ||
| 5-1253545-AGGCCTCAGCCGGACACTCAGCCTTCAGCCGGACATGCAGGCCTCGGCCAAACACTCACTCAGGCCTCAGACTCCCAGCGGTGCGGGCCTGGGTGTGGGCCGCCCCTCCCTCCCTGGGACGTAGAGCCCGGCGTGACAGGGCTGCTGGTGTCTGCTCTCGGCCTGGCTGTGGGCGGGT-A | Interstitial lung disease 2 | Pathogenic (May 10, 2012) | ||
| 5-1253575-G-A | Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Dyskeratosis congenita, autosomal dominant 2 • Aplastic anemia | Benign (Jan 13, 2018) | ||
| 5-1253624-G-A | Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Aplastic anemia • Dyskeratosis congenita, autosomal dominant 2 | Uncertain significance (Jan 13, 2018) | ||
| 5-1253629-G-A | Dyskeratosis congenita, autosomal dominant 2 • Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Aplastic anemia • not specified | Benign (Jan 24, 2024) | ||
| 5-1253645-C-T | Dyskeratosis congenita, autosomal dominant 2 • Aplastic anemia • Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 | Uncertain significance (Jan 17, 2018) | ||
| 5-1253664-C-T | Dyskeratosis congenita, autosomal dominant 2 • Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Aplastic anemia | Uncertain significance (Jan 13, 2018) | ||
| 5-1253665-G-A | Dyskeratosis congenita, autosomal dominant 2 • Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 • Aplastic anemia | Benign/Likely benign (Feb 14, 2019) | ||
| 5-1253718-C-T | TERT-related disorder | Likely benign (May 04, 2022) | ||
| 5-1253728-T-C | Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 1 | Likely pathogenic (Nov 23, 2017) | ||
| 5-1253736-G-A | Idiopathic Pulmonary Fibrosis;Dyskeratosis congenita, autosomal dominant 2 | Likely benign (Feb 01, 2023) | ||
| 5-1253740-G-A | Dyskeratosis congenita | Likely benign (Dec 15, 2023) | ||
| 5-1253741-G-C | Dyskeratosis congenita • Idiopathic Pulmonary Fibrosis;Dyskeratosis congenita, autosomal dominant 2 | Uncertain significance (Jul 07, 2023) | ||
| 5-1253741-G-T | Dyskeratosis congenita, autosomal dominant 2;Idiopathic Pulmonary Fibrosis | Uncertain significance (Dec 12, 2020) | ||
| 5-1253746-G-A | Dyskeratosis congenita, autosomal dominant 2;Idiopathic Pulmonary Fibrosis | Likely benign (Oct 08, 2021) | ||
| 5-1253749-G-A | Dyskeratosis congenita, autosomal dominant 2;Idiopathic Pulmonary Fibrosis | Likely benign (Jan 12, 2024) | ||
| 5-1253752-T-C | Dyskeratosis congenita | Likely benign (Jun 20, 2021) | ||
| 5-1253753-G-A | TERT-related disorder | Uncertain significance (Mar 29, 2024) | ||
| 5-1253754-A-C | Dyskeratosis congenita, autosomal dominant 2;Idiopathic Pulmonary Fibrosis • Dyskeratosis congenita | Conflicting classifications of pathogenicity (Oct 27, 2022) | ||
| 5-1253755-G-C | Dyskeratosis congenita, autosomal dominant 2;Idiopathic Pulmonary Fibrosis • Dyskeratosis congenita | Likely benign (Apr 18, 2023) | ||
| 5-1253756-G-A | Dyskeratosis congenita, autosomal dominant 2;Idiopathic Pulmonary Fibrosis | Uncertain significance (Mar 13, 2021) | ||
| 5-1253758-C-T | Idiopathic Pulmonary Fibrosis;Dyskeratosis congenita, autosomal dominant 2 • Dyskeratosis congenita | Likely benign (Jan 24, 2024) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| TERT | protein_coding | protein_coding | ENST00000310581 | 16 | 41923 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 0.990 | 0.00954 | 125724 | 0 | 23 | 125747 | 0.0000915 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | 4.88 | 350 | 718 | 0.488 | 0.0000537 | 7124 |
| Missense in Polyphen | 45 | 208.81 | 0.2155 | 2420 | ||
| Synonymous | 0.251 | 330 | 336 | 0.983 | 0.0000264 | 2503 |
| Loss of Function | 5.24 | 7 | 44.8 | 0.156 | 0.00000232 | 457 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.0000290 | 0.0000290 |
| Ashkenazi Jewish | 0.00 | 0.00 |
| East Asian | 0.00 | 0.00 |
| Finnish | 0.000608 | 0.000601 |
| European (Non-Finnish) | 0.0000565 | 0.0000527 |
| Middle Eastern | 0.00 | 0.00 |
| South Asian | 0.0000653 | 0.0000653 |
| Other | 0.000167 | 0.000163 |
dbNSFP
Source:
- Function
- FUNCTION: Telomerase is a ribonucleoprotein enzyme essential for the replication of chromosome termini in most eukaryotes. Active in progenitor and cancer cells. Inactive, or very low activity, in normal somatic cells. Catalytic component of the teleromerase holoenzyme complex whose main activity is the elongation of telomeres by acting as a reverse transcriptase that adds simple sequence repeats to chromosome ends by copying a template sequence within the RNA component of the enzyme. Catalyzes the RNA- dependent extension of 3'-chromosomal termini with the 6- nucleotide telomeric repeat unit, 5'-TTAGGG-3'. The catalytic cycle involves primer binding, primer extension and release of product once the template boundary has been reached or nascent product translocation followed by further extension. More active on substrates containing 2 or 3 telomeric repeats. Telomerase activity is regulated by a number of factors including telomerase complex-associated proteins, chaperones and polypeptide modifiers. Modulates Wnt signaling. Plays important roles in aging and antiapoptosis. {ECO:0000269|PubMed:14963003, ECO:0000269|PubMed:15082768, ECO:0000269|PubMed:15857955, ECO:0000269|PubMed:17026956, ECO:0000269|PubMed:17264120, ECO:0000269|PubMed:17296728, ECO:0000269|PubMed:17548608, ECO:0000269|PubMed:19188162, ECO:0000269|PubMed:19567472, ECO:0000269|PubMed:19571879, ECO:0000269|PubMed:19777057, ECO:0000269|PubMed:9389643}.;
- Disease
- DISEASE: Note=Activation of telomerase has been implicated in cell immortalization and cancer cell pathogenesis.; DISEASE: Aplastic anemia (AA) [MIM:609135]: A form of anemia in which the bone marrow fails to produce adequate numbers of peripheral blood elements. It is characterized by peripheral pancytopenia and marrow hypoplasia. {ECO:0000269|PubMed:15885610, ECO:0000269|PubMed:16627250, ECO:0000269|PubMed:16990594, ECO:0000269|PubMed:19760749}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.; DISEASE: Note=Genetic variations in TERT are associated with coronary artery disease (CAD).; DISEASE: Dyskeratosis congenita, autosomal dominant, 2 (DKCA2) [MIM:613989]: A rare multisystem disorder caused by defective telomere maintenance. It is characterized by progressive bone marrow failure, and the clinical triad of reticulated skin hyperpigmentation, nail dystrophy, and mucosal leukoplakia. Common but variable features include premature graying, aplastic anemia, low platelets, osteoporosis, pulmonary fibrosis, and liver fibrosis among others. Early mortality is often associated with bone marrow failure, infections, fatal pulmonary complications, or malignancy. {ECO:0000269|PubMed:15885610, ECO:0000269|PubMed:16247010, ECO:0000269|PubMed:21602826}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Pulmonary fibrosis, and/or bone marrow failure, telomere- related, 1 (PFBMFT1) [MIM:614742]: A disease associated with shortened telomeres. Pulmonary fibrosis is the most common manifestation. Other manifestations include aplastic anemia due to bone marrow failure, hepatic fibrosis, and increased cancer risk, particularly myelodysplastic syndrome and acute myeloid leukemia. Phenotype, age at onset, and severity are determined by telomere length. {ECO:0000269|PubMed:15814878, ECO:0000269|PubMed:17460043, ECO:0000269|PubMed:21436073, ECO:0000269|PubMed:21483807, ECO:0000269|PubMed:22512499}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Dyskeratosis congenita, autosomal recessive, 4 (DKCB4) [MIM:613989]: A severe form of dyskeratosis congenita, a rare multisystem disorder caused by defective telomere maintenance. It is characterized by progressive bone marrow failure, and the clinical triad of reticulated skin hyperpigmentation, nail dystrophy, and mucosal leukoplakia. Common but variable features include premature graying, aplastic anemia, low platelets, osteoporosis, pulmonary fibrosis, and liver fibrosis among others. Early mortality is often associated with bone marrow failure, infections, fatal pulmonary complications, or malignancy. {ECO:0000269|PubMed:16332973, ECO:0000269|PubMed:17785587, ECO:0000269|PubMed:18042801, ECO:0000269|PubMed:21602826}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Pulmonary fibrosis, idiopathic (IPF) [MIM:178500]: A lung disease characterized by shortness of breath, radiographically evident diffuse pulmonary infiltrates, and varying degrees of inflammation and fibrosis on biopsy. In some cases, the disorder can be rapidly progressive and characterized by sequential acute lung injury with subsequent scarring and end-stage lung disease. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.; DISEASE: Melanoma, cutaneous malignant 9 (CMM9) [MIM:615134]: A malignant neoplasm of melanocytes, arising de novo or from a pre- existing benign nevus, which occurs most often in the skin but also may involve other sites. {ECO:0000269|PubMed:23348503}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.;
- Pathway
- Gastric cancer - Homo sapiens (human);HTLV-I infection - Homo sapiens (human);Hepatocellular carcinoma - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);Human papillomavirus infection - Homo sapiens (human);miR-targeted genes in epithelium - TarBase;miR-targeted genes in lymphocytes - TarBase;Lung fibrosis;TGF-beta Signaling Pathway;Signaling by WNT;Signal Transduction;telomeres telomerase cellular aging and immortality;overview of telomerase protein component gene htert transcriptional regulation;erk1/erk2 mapk signaling pathway;Telomere Extension By Telomerase;Extension of Telomeres;Telomere Maintenance;Chromosome Maintenance;role of nicotinic acetylcholine receptors in the regulation of apoptosis;IL2;Cell Cycle;Regulation of nuclear beta catenin signaling and target gene transcription;Validated targets of C-MYC transcriptional activation;Regulation of Telomerase;IL2 signaling events mediated by PI3K;Formation of the beta-catenin:TCF transactivating complex;TCF dependent signaling in response to WNT;HIF-1-alpha transcription factor network
(Consensus)
Recessive Scores
- pRec
- 0.675
Haploinsufficiency Scores
- pHI
- 0.229
- hipred
- Y
- hipred_score
- 0.693
- ghis
- 0.432
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- N
- gene_indispensability_score
- 0.287
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | Medium | Medium | Medium |
| Primary Immunodeficiency | Medium | Medium | Medium |
| Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Tert
- Phenotype
- neoplasm; hematopoietic system phenotype; reproductive system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); normal phenotype; respiratory system phenotype; skeleton phenotype; immune system phenotype; digestive/alimentary phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); taste/olfaction phenotype; endocrine/exocrine gland phenotype; growth/size/body region phenotype; homeostasis/metabolism phenotype; cellular phenotype;
Zebrafish Information Network
- Gene name
- tert
- Affected structure
- nucleate erythrocyte
- Phenotype tag
- abnormal
- Phenotype quality
- decreased amount
Gene ontology
- Biological process
- telomere maintenance;transcription, RNA-templated;RNA-dependent DNA biosynthetic process;telomere maintenance via telomerase;mitochondrion organization;negative regulation of gene expression;DNA strand elongation;positive regulation of Wnt signaling pathway;production of siRNA involved in RNA interference;regulation of protein stability;positive regulation of protein binding;RNA biosynthetic process;positive regulation of hair cycle;negative regulation of neuron apoptotic process;positive regulation of angiogenesis;positive regulation of glucose import;response to cadmium ion;positive regulation of nitric-oxide synthase activity;negative regulation of glial cell proliferation;establishment of protein localization to telomere;cellular response to hypoxia;DNA biosynthetic process;replicative senescence;positive regulation of G1/S transition of mitotic cell cycle;positive regulation of pri-miRNA transcription by RNA polymerase II;positive regulation of transdifferentiation;negative regulation of production of siRNA involved in RNA interference;positive regulation of vascular smooth muscle cell proliferation;positive regulation of protein localization to nucleolus;positive regulation of vascular associated smooth muscle cell migration;beta-catenin-TCF complex assembly;negative regulation of endothelial cell apoptotic process;positive regulation of stem cell proliferation;negative regulation of cellular senescence;negative regulation of extrinsic apoptotic signaling pathway in absence of ligand
- Cellular component
- telomerase catalytic core complex;chromosome, telomeric region;nuclear telomere cap complex;nuclear chromosome, telomeric region;nucleus;nucleoplasm;telomerase holoenzyme complex;nucleolus;cytosol;plasma membrane;PML body;nuclear speck;RNA-directed RNA polymerase complex;mitochondrial nucleoid;TERT-RMRP complex
- Molecular function
- tRNA binding;transcription coactivator binding;DNA binding;telomerase activity;telomerase RNA reverse transcriptase activity;RNA binding;RNA-directed DNA polymerase activity;RNA-directed 5'-3' RNA polymerase activity;protein binding;protein C-terminus binding;nucleotidyltransferase activity;telomeric DNA binding;identical protein binding;protein homodimerization activity;metal ion binding;protein N-terminus binding;chaperone binding;telomerase RNA binding;template-free RNA nucleotidyltransferase