1-109621129-G-GCCGGTGCCGCTCAGACTCCC

Variant names:

• chr1-109621129-G-GCCGGTGCCGCTCAGACTCCC
• NM_001368809.2:c.-43_-24dupGTGCCGCTCAGACTCCCCCG

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_001308170.1(AMPD2):​c.26_45dupGTGCCGCTCAGACTCCCCCG​(p.Leu16ValfsTer32) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: AMPD2 NM_001308170.1 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.11

Genes affected

AMPD2 (HGNC:469): (adenosine monophosphate deaminase 2) The protein encoded by this gene is important in purine metabolism by converting AMP to IMP. The encoded protein, which acts as a homotetramer, is one of three AMP deaminases found in mammals. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 45 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 1-109621129-G-GCCGGTGCCGCTCAGACTCCC is Pathogenic according to our data. Variant chr1-109621129-G-GCCGGTGCCGCTCAGACTCCC is described in ClinVar as [Pathogenic]. Clinvar id is 1991577.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AMPD2	NM_001368809.2	c.-43_-24dupGTGCCGCTCAGACTCCCCCG		5_prime_UTR_variant	Exon 2 of 19	ENST00000528667.7	NP_001355738.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AMPD2	ENST00000528667.7	c.-43_-24dupGTGCCGCTCAGACTCCCCCG		5_prime_UTR_variant	Exon 2 of 19	1	NM_001368809.2	ENSP00000436541.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 34

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary spastic paraplegia 63;C4014354:Pontocerebellar hypoplasia type 9 Pathogenic:1

Mar 19, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Ala47Glyfs*147) in the AMPD2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in AMPD2 are known to be pathogenic (PMID: 23911318). For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. This variant has not been reported in the literature in individuals affected with AMPD2-related conditions. This variant is not present in population databases (gnomAD no frequency). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr1-110163751;