NM_001368809.2:c.-43_-24dupGTGCCGCTCAGACTCCCCCG
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PP5_Moderate
The NM_001368809.2(AMPD2):c.-43_-24dupGTGCCGCTCAGACTCCCCCG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_001368809.2 5_prime_UTR
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
AMPD2 | NM_001368809.2 | c.-43_-24dupGTGCCGCTCAGACTCCCCCG | 5_prime_UTR_variant | Exon 2 of 19 | ENST00000528667.7 | NP_001355738.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
AMPD2 | ENST00000528667 | c.-43_-24dupGTGCCGCTCAGACTCCCCCG | 5_prime_UTR_variant | Exon 2 of 19 | 1 | NM_001368809.2 | ENSP00000436541.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 34
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Hereditary spastic paraplegia 63;C4014354:Pontocerebellar hypoplasia type 9 Pathogenic:1
This sequence change creates a premature translational stop signal (p.Ala47Glyfs*147) in the AMPD2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in AMPD2 are known to be pathogenic (PMID: 23911318). For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. This variant has not been reported in the literature in individuals affected with AMPD2-related conditions. This variant is not present in population databases (gnomAD no frequency). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.