1-1232594-CGGCGCGCCCTGGAGCGGGAGCA-C

Position:

• chr1-1232594-CGGCGCGCCCTGGAGCGGGAGCA-C

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_080605.4(B3GALT6):​c.323_344delCCCTGGAGCGGGAGCAGGCGCG​(p.Ala108fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. A108A) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: B3GALT6 NM_080605.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 7.62

Genes affected

B3GALT6 (HGNC:17978): (beta-1,3-galactosyltransferase 6) The enzyme encoded by this intronless gene is a beta-1,3-galactosyltransferase found in the medial Golgi apparatus, where it catalyzes the transfer of galactose from UDP-galactose to substrates containing a terminal beta-linked galactose moiety. The encoded enzyme has a particular affinity for galactose-beta-1,4-xylose found in the linker region of glycosamines. This enzyme is required for glycosaminoglycan synthesis. [provided by RefSeq, Jun 2013]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 23 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 1-1232594-CGGCGCGCCCTGGAGCGGGAGCA-C is Pathogenic according to our data. Variant chr1-1232594-CGGCGCGCCCTGGAGCGGGAGCA-C is described in ClinVar as [Pathogenic]. Clinvar id is 60497.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
B3GALT6	NM_080605.4	c.323_344delCCCTGGAGCGGGAGCAGGCGCG	p.Ala108fs	frameshift_variant	1/1	ENST00000379198.5	NP_542172.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
B3GALT6	ENST00000379198.5	c.323_344delCCCTGGAGCGGGAGCAGGCGCG	p.Ala108fs	frameshift_variant	1/1	6	NM_080605.4	ENSP00000368496.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Spondyloepimetaphyseal dysplasia with joint laxity, type 1, with fractures Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Jun 06, 2013

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs786200943; hg19: chr1-1167974;