rs786200943

Variant names:

• chr1-1232594-CGGCGCGCCCTGGAGCGGGAGCA-C
• rs786200943
• NM_080605.4:c.323_344delCCCTGGAGCGGGAGCAGGCGCG

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_080605.4(B3GALT6):​c.323_344delCCCTGGAGCGGGAGCAGGCGCG​(p.Ala108GlyfsTer163) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. A108A) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: B3GALT6 NM_080605.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 7.62
• Publications: 1 publications found

Genes affected

B3GALT6 (HGNC:17978): (beta-1,3-galactosyltransferase 6) The enzyme encoded by this intronless gene is a beta-1,3-galactosyltransferase found in the medial Golgi apparatus, where it catalyzes the transfer of galactose from UDP-galactose to substrates containing a terminal beta-linked galactose moiety. The encoded enzyme has a particular affinity for galactose-beta-1,4-xylose found in the linker region of glycosamines. This enzyme is required for glycosaminoglycan synthesis. [provided by RefSeq, Jun 2013]

B3GALT6 Gene-Disease associations (from GenCC):

• Ehlers-Danlos syndrome, spondylodysplastic type, 2

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, Genomics England PanelApp
• spondyloepimetaphyseal dysplasia with joint laxity, type 1, with or without fractures

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• spondyloepimetaphyseal dysplasia with joint laxity

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 28 pathogenic variants in the truncated region.
• PP5: Variant 1-1232594-CGGCGCGCCCTGGAGCGGGAGCA-C is Pathogenic according to our data. Variant chr1-1232594-CGGCGCGCCCTGGAGCGGGAGCA-C is described in ClinVar as [Pathogenic]. Clinvar id is 60497.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
B3GALT6	NM_080605.4	c.323_344delCCCTGGAGCGGGAGCAGGCGCG	p.Ala108GlyfsTer163	frameshift_variant	Exon 1 of 1	ENST00000379198.5	NP_542172.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
B3GALT6	ENST00000379198.5	c.323_344delCCCTGGAGCGGGAGCAGGCGCG	p.Ala108GlyfsTer163	frameshift_variant	Exon 1 of 1	6	NM_080605.4	ENSP00000368496.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Spondyloepimetaphyseal dysplasia with joint laxity, type 1, with fractures Pathogenic:1

Jun 06, 2013

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.6
Mutation Taster		=29/171	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs786200943; hg19: chr1-1167974;