rs786200943

Variant names:

• chr1-1232594-CGGCGCGCCCTGGAGCGGGAGCA-C
• rs786200943
• NM_080605.4:c.323_344delCCCTGGAGCGGGAGCAGGCGCG

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_080605.4(B3GALT6):​c.323_344delCCCTGGAGCGGGAGCAGGCGCG​(p.Ala108GlyfsTer163) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. A108A) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: B3GALT6 NM_080605.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 7.62
• Publications: 2 publications found

Genes affected

B3GALT6 (HGNC:17978): (beta-1,3-galactosyltransferase 6) The enzyme encoded by this intronless gene is a beta-1,3-galactosyltransferase found in the medial Golgi apparatus, where it catalyzes the transfer of galactose from UDP-galactose to substrates containing a terminal beta-linked galactose moiety. The encoded enzyme has a particular affinity for galactose-beta-1,4-xylose found in the linker region of glycosamines. This enzyme is required for glycosaminoglycan synthesis. [provided by RefSeq, Jun 2013]

SDF4 (HGNC:24188): (stromal cell derived factor 4) This gene encodes a stromal cell derived factor that is a member of the CREC protein family. The encoded protein contains six EF-hand motifs and calcium-binding motifs. This protein localizes to the Golgi lumen and may be involved in regulating calcium dependent cellular activities. [provided by RefSeq, Sep 2011]

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 28 pathogenic variants in the truncated region.
• PP5: Variant 1-1232594-CGGCGCGCCCTGGAGCGGGAGCA-C is Pathogenic according to our data. Variant chr1-1232594-CGGCGCGCCCTGGAGCGGGAGCA-C is described in ClinVar as Pathogenic. ClinVar VariationId is 60497.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_080605.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	B3GALT6	NM_080605.4	MANE Select	c.323_344delCCCTGGAGCGGGAGCAGGCGCG	p.Ala108GlyfsTer163	frameshift	Exon 1 of 1	NP_542172.2	Q96L58

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	B3GALT6	ENST00000379198.5	TSL:6 MANE Select	c.323_344delCCCTGGAGCGGGAGCAGGCGCG	p.Ala108GlyfsTer163	frameshift	Exon 1 of 1	ENSP00000368496.2	Q96L58
	SDF4	ENST00000900948.1		c.-174-3670_-174-3649delTGCTCCCGCTCCAGGGCGCGCC		intron	N/A	ENSP00000571007.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Spondyloepimetaphyseal dysplasia with joint laxity, type 1, with fractures (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.6
Mutation Taster		=29/171	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs786200943;

hg19: chr1-1167974;