1-1435798-TGGCGCGGAGC-TGGCGCGGAGCGGCGCGGAGCGGCGCGGAGC

Variant names:

• chr1-1435798-T-TGGCGCGGAGCGGCGCGGAGC
• rs749383814
• NM_022834.5:c.52_71dupGCGCGGAGCGGCGCGGAGCG

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PVS1_Strong PP5

The NM_022834.5(VWA1):​c.52_71dupGCGCGGAGCGGCGCGGAGCG​(p.Gly25ArgfsTer18) variant causes a frameshift, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 9.5e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: VWA1 NM_022834.5 frameshift, splice_region
• Clinical Significance: Likely pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 0.706
• Publications: 1 publications found

Genes affected

VWA1 (HGNC:30910): (von Willebrand factor A domain containing 1) VWA1 belongs to the von Willebrand factor (VWF; MIM 613160) A (VWFA) domain superfamily of extracellular matrix proteins and appears to play a role in cartilage structure and function (Fitzgerald et al., 2002 [PubMed 12062410]).[supplied by OMIM, Nov 2010]

LOC107985729 (HGNC:):

LINC01770 (HGNC:52560): (long intergenic non-protein coding RNA 1770)

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 17 pathogenic variants in the truncated region.
• PP5: Variant 1-1435798-T-TGGCGCGGAGCGGCGCGGAGC is Pathogenic according to our data. Variant chr1-1435798-T-TGGCGCGGAGCGGCGCGGAGC is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 3031419.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_022834.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VWA1	NM_022834.5	MANE Select	c.52_71dupGCGCGGAGCGGCGCGGAGCG	p.Gly25ArgfsTer18	frameshift splice_region	Exon 1 of 3	NP_073745.2
	VWA1	NM_199121.3		c.52_71dupGCGCGGAGCGGCGCGGAGCG	p.Gly25ArgfsTer297	frameshift splice_region	Exon 1 of 3	NP_954572.2	Q6PCB0-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VWA1	ENST00000476993.2	TSL:1 MANE Select	c.52_71dupGCGCGGAGCGGCGCGGAGCG	p.Gly25ArgfsTer18	frameshift splice_region	Exon 1 of 3	ENSP00000417185.1	Q6PCB0-1
	VWA1	ENST00000895635.1		c.52_71dupGCGCGGAGCGGCGCGGAGCG	p.Ala25ArgfsTer15	frameshift splice_region	Exon 1 of 3	ENSP00000565694.1
	VWA1	ENST00000895634.1		c.52_71dupGCGCGGAGCGGCGCGGAGCG	p.Asp25ArgfsTer33	frameshift splice_region	Exon 1 of 2	ENSP00000565693.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 9.50e-7 AC: 1 AN: 1052946 Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0 AN XY: 511502

African (AFR) AF: 0.00 AC: 0 AN: 20024

American (AMR) AF: 0.00 AC: 0 AN: 8792

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 11896

East Asian (EAS) AF: 0.00 AC: 0 AN: 13984

South Asian (SAS) AF: 0.00 AC: 0 AN: 38854

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 18224

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2840

European-Non Finnish (NFE) AF: 0.00000111 AC: 1 AN: 899368

Other (OTH) AF: 0.00 AC: 0 AN: 38964

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	VWA1-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.71

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs749383814; hg19: chr1-1371178;