NM_022834.5:c.52_71dupGCGCGGAGCGGCGCGGAGCG
Variant summary
Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PVS1_StrongPM2PP5
The NM_022834.5(VWA1):c.52_71dupGCGCGGAGCGGCGCGGAGCG(p.Gly25ArgfsTer18) variant causes a frameshift, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (no stars).
Frequency
Consequence
NM_022834.5 frameshift, splice_region
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 7 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
VWA1 | NM_022834.5 | c.52_71dupGCGCGGAGCGGCGCGGAGCG | p.Gly25ArgfsTer18 | frameshift_variant, splice_region_variant | Exon 1 of 3 | ENST00000476993.2 | NP_073745.2 | |
VWA1 | NM_199121.3 | c.52_71dupGCGCGGAGCGGCGCGGAGCG | p.Gly25ArgfsTer297 | frameshift_variant, splice_region_variant | Exon 1 of 3 | NP_954572.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
VWA1 | ENST00000476993.2 | c.52_71dupGCGCGGAGCGGCGCGGAGCG | p.Gly25ArgfsTer18 | frameshift_variant, splice_region_variant | Exon 1 of 3 | 1 | NM_022834.5 | ENSP00000417185.1 | ||
VWA1 | ENST00000471398.1 | c.52_71dupGCGCGGAGCGGCGCGGAGCG | p.Gly25ArgfsTer58 | frameshift_variant, splice_region_variant | Exon 1 of 2 | 3 | ENSP00000464343.1 | |||
VWA1 | ENST00000338660.5 | c.52_71dupGCGCGGAGCGGCGCGGAGCG | p.Gly25ArgfsTer297 | frameshift_variant, splice_region_variant | Exon 1 of 3 | 2 | ENSP00000423404.1 | |||
VWA1 | ENST00000495558.1 | c.-33+654_-33+673dupGCGCGGAGCGGCGCGGAGCG | intron_variant | Intron 1 of 1 | 2 | ENSP00000463643.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 9.50e-7 AC: 1AN: 1052946Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0AN XY: 511502
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
VWA1-related disorder Pathogenic:1
The VWA1 c.52_71dup20 variant is predicted to result in a frameshift and premature protein termination (p.Gly25Argfs*18). To our knowledge, this variant has not been reported in the literature or in a large population database, indicating this variant is rare. Frameshift variants in VWA1 are expected to be pathogenic. This variant is interpreted as likely pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at