1-147757495-G-GGGGCATTTGCCAGAGGTACATACCA

Variant names:

• chr1-147757495-G-GGGGCATTTGCCAGAGGTACATACCA
• rs11267274
• NM_181703.4:c.*642_*666dupTGGTATGTACCTCTGGCAAATGCCC

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_181703.4(GJA5):​c.*642_*666dupTGGTATGTACCTCTGGCAAATGCCC variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency: Genomes: not found (cov: 0)
• Consequence: GJA5 NM_181703.4 3_prime_UTR
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.00
• Publications: 1 publications found

Genes affected

GJA5 (HGNC:4279): (gap junction protein alpha 5) This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene may be associated with atrial fibrillation. Alternatively spliced transcript variants encoding the same isoform have been described. [provided by RefSeq, Jul 2008]

GJA5 Gene-Disease associations (from GenCC):

• atrial fibrillation, familial, 11

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
• familial atrial fibrillation

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• heart conduction disease

  Inheritance: AD Classification: LIMITED Submitted by: Genomics England PanelApp
• congenital heart disease

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ENSG00000274415 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 1-147757495-G-GGGGCATTTGCCAGAGGTACATACCA is Benign according to our data. Variant chr1-147757495-G-GGGGCATTTGCCAGAGGTACATACCA is described in ClinVar as Likely_benign. ClinVar VariationId is 292439.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_181703.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GJA5	NM_181703.4	MANE Select	c.*642_*666dupTGGTATGTACCTCTGGCAAATGCCC		3_prime_UTR	Exon 2 of 2	NP_859054.1	P36382
	GJA5	NM_005266.7		c.*642_*666dupTGGTATGTACCTCTGGCAAATGCCC		3_prime_UTR	Exon 2 of 2	NP_005257.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GJA5	ENST00000579774.3	TSL:1 MANE Select	c.*642_*666dupTGGTATGTACCTCTGGCAAATGCCC		3_prime_UTR	Exon 2 of 2	ENSP00000463851.1	P36382
	GJA5	ENST00000621517.1	TSL:2	c.*642_*666dupTGGTATGTACCTCTGGCAAATGCCC		3_prime_UTR	Exon 2 of 2	ENSP00000484552.1	P36382
	GJA5	ENST00000863529.1		c.*642_*666dupTGGTATGTACCTCTGGCAAATGCCC		3_prime_UTR	Exon 2 of 2	ENSP00000533588.1

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome Cov.: 0

GnomAD4 genome Cov.: 0

Alfa AF: 0.155 Hom.: 1430

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	Familial atrial fibrillation (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs11267274; hg19: chr1-147229628;