rs11267274

Variant names:

• chr1-147757495-GGGGCATTTGCCAGAGGTACATACCA-G
• rs11267274
• NM_181703.4:c.*642_*666delTGGTATGTACCTCTGGCAAATGCCC

Your query was ambiguous. Multiple possible variants found:

• chr1-147757495-GGGGCATTTGCCAGAGGTACATACCA-G
• chr1-147757495-GGGGCATTTGCCAGAGGTACATACCA-GGGGCATTTGCCAGAGGTACATACCAGGGCATTTGCCAGAGGTACATACCA

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1

The NM_181703.4(GJA5):​c.*642_*666delTGGTATGTACCTCTGGCAAATGCCC variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.486 in 155,292 control chromosomes in the GnomAD database, including 18,640 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.49 (18246 hom., cov: 0)
  • Exomes 𝑓: 0.42 (394 hom.)
• Consequence: GJA5 NM_181703.4 3_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00
• Publications: 1 publications found

Genes affected

GJA5 (HGNC:4279): (gap junction protein alpha 5) This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene may be associated with atrial fibrillation. Alternatively spliced transcript variants encoding the same isoform have been described. [provided by RefSeq, Jul 2008]

GJA5 Gene-Disease associations (from GenCC):

• atrial fibrillation, familial, 11

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
• familial atrial fibrillation

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• heart conduction disease

  Inheritance: AD Classification: LIMITED Submitted by: Genomics England PanelApp
• congenital heart disease

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ENSG00000274415 (HGNC:):

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.582 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_181703.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GJA5	NM_181703.4	MANE Select	c.*642_*666delTGGTATGTACCTCTGGCAAATGCCC		3_prime_UTR	Exon 2 of 2	NP_859054.1	P36382
	GJA5	NM_005266.7		c.*642_*666delTGGTATGTACCTCTGGCAAATGCCC		3_prime_UTR	Exon 2 of 2	NP_005257.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GJA5	ENST00000579774.3	TSL:1 MANE Select	c.*642_*666delTGGTATGTACCTCTGGCAAATGCCC		3_prime_UTR	Exon 2 of 2	ENSP00000463851.1	P36382
	GJA5	ENST00000621517.1	TSL:2	c.*642_*666delTGGTATGTACCTCTGGCAAATGCCC		3_prime_UTR	Exon 2 of 2	ENSP00000484552.1	P36382
	GJA5	ENST00000863529.1		c.*642_*666delTGGTATGTACCTCTGGCAAATGCCC		3_prime_UTR	Exon 2 of 2	ENSP00000533588.1

Frequencies

GnomAD3 genomes AF: 0.488 AC: 73628 AN: 151022 Hom.: 18185 Cov.: 0

Gnomad AFR AF: 0.584

Gnomad AMI AF: 0.515

Gnomad AMR AF: 0.528

Gnomad ASJ AF: 0.411

Gnomad EAS AF: 0.599

Gnomad SAS AF: 0.451

Gnomad FIN AF: 0.402

Gnomad MID AF: 0.320

Gnomad NFE AF: 0.432

Gnomad OTH AF: 0.491

GnomAD4 exome AF: 0.425 AC: 1766 AN: 4156 Hom.: 394 AF XY: 0.421 AC XY: 906 AN XY: 2150

African (AFR) AF: 0.500 AC: 4 AN: 8

American (AMR) AF: 0.504 AC: 574 AN: 1138

Ashkenazi Jewish (ASJ) AF: 0.438 AC: 7 AN: 16

East Asian (EAS) AF: 0.500 AC: 40 AN: 80

South Asian (SAS) AF: 0.432 AC: 139 AN: 322

European-Finnish (FIN) AF: 0.250 AC: 2 AN: 8

Middle Eastern (MID) AC: 0 AN: 0

European-Non Finnish (NFE) AF: 0.385 AC: 942 AN: 2446

Other (OTH) AF: 0.420 AC: 58 AN: 138

GnomAD4 genome AF: 0.488 AC: 73752 AN: 151136 Hom.: 18246 Cov.: 0 AF XY: 0.485 AC XY: 35834 AN XY: 73842

African (AFR) AF: 0.585 AC: 24029 AN: 41080

American (AMR) AF: 0.529 AC: 8018 AN: 15166

Ashkenazi Jewish (ASJ) AF: 0.411 AC: 1422 AN: 3460

East Asian (EAS) AF: 0.599 AC: 3052 AN: 5092

South Asian (SAS) AF: 0.451 AC: 2155 AN: 4780

European-Finnish (FIN) AF: 0.402 AC: 4229 AN: 10532

Middle Eastern (MID) AF: 0.330 AC: 97 AN: 294

European-Non Finnish (NFE) AF: 0.432 AC: 29247 AN: 67724

Other (OTH) AF: 0.493 AC: 1034 AN: 2098

Alfa AF: 0.353 Hom.: 1430

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs11267274; hg19: chr1-147229628;