1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant names:

• chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCT
• rs3831942
• NM_002249.6:c.221_241dupAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_Strong BA1

The NM_002249.6(KCNN3):​c.221_241dupAGCAGCAGCAGCAGCAGCAGC​(p.Gln74_Gln80dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.049 (262 hom., cov: 0)
  • Exomes 𝑓: 0.056 (2497 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNN3 NM_002249.6 conservative_inframe_insertion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 2.12
• Publications: 18 publications found

Genes affected

KCNN3 (HGNC:6292): (potassium calcium-activated channel subfamily N member 3) Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]

KCNN3 Gene-Disease associations (from GenCC):

• Zimmermann-Laband syndrome 3

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• Zimmermann-Laband syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• schizophrenia

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000308854 (HGNC:):

ACMG classification

Our verdict: Benign. The variant received -16 ACMG points.

• BP6: Variant 1-154869723-G-GGCTGCTGCTGCTGCTGCTGCT is Benign according to our data. Variant chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCT is described in CliVar as Benign. Clinvar id is 1685432.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCT is described in CliVar as Benign. Clinvar id is 1685432.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCT is described in CliVar as Benign. Clinvar id is 1685432.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCT is described in CliVar as Benign. Clinvar id is 1685432.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCT is described in CliVar as Benign. Clinvar id is 1685432.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.0586 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNN3	NM_002249.6	c.221_241dupAGCAGCAGCAGCAGCAGCAGC	p.Gln74_Gln80dup	conservative_inframe_insertion	Exon 1 of 8	ENST00000271915.9	NP_002240.3
KCNN3	NM_001204087.2	c.221_241dupAGCAGCAGCAGCAGCAGCAGC	p.Gln74_Gln80dup	conservative_inframe_insertion	Exon 1 of 9		NP_001191016.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNN3	ENST00000271915.9	c.221_241dupAGCAGCAGCAGCAGCAGCAGC	p.Gln74_Gln80dup	conservative_inframe_insertion	Exon 1 of 8	1	NM_002249.6	ENSP00000271915.3

Frequencies

GnomAD3 genomes AF: 0.0491 AC: 6935 AN: 141176 Hom.: 261 Cov.: 0

Gnomad AFR AF: 0.0407

Gnomad AMI AF: 0.184

Gnomad AMR AF: 0.0326

Gnomad ASJ AF: 0.0264

Gnomad EAS AF: 0.0493

Gnomad SAS AF: 0.0383

Gnomad FIN AF: 0.0314

Gnomad MID AF: 0.0298

Gnomad NFE AF: 0.0602

Gnomad OTH AF: 0.0515

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0562 AC: 76400 AN: 1358946 Hom.: 2497 Cov.: 112 AF XY: 0.0554 AC XY: 37211 AN XY: 671666

African (AFR) AF: 0.0426 AC: 1319 AN: 30998

American (AMR) AF: 0.0308 AC: 1090 AN: 35384

Ashkenazi Jewish (ASJ) AF: 0.0305 AC: 758 AN: 24880

East Asian (EAS) AF: 0.0369 AC: 1310 AN: 35526

South Asian (SAS) AF: 0.0399 AC: 3135 AN: 78498

European-Finnish (FIN) AF: 0.0324 AC: 1493 AN: 46084

Middle Eastern (MID) AF: 0.0287 AC: 127 AN: 4422

European-Non Finnish (NFE) AF: 0.0614 AC: 64292 AN: 1046574

Other (OTH) AF: 0.0508 AC: 2876 AN: 56580

GnomAD4 genome AF: 0.0492 AC: 6951 AN: 141278 Hom.: 262 Cov.: 0 AF XY: 0.0473 AC XY: 3212 AN XY: 67962

African (AFR) AF: 0.0410 AC: 1551 AN: 37814

American (AMR) AF: 0.0325 AC: 460 AN: 14150

Ashkenazi Jewish (ASJ) AF: 0.0264 AC: 89 AN: 3376

East Asian (EAS) AF: 0.0493 AC: 227 AN: 4608

South Asian (SAS) AF: 0.0381 AC: 154 AN: 4040

European-Finnish (FIN) AF: 0.0314 AC: 286 AN: 9116

Middle Eastern (MID) AF: 0.0319 AC: 9 AN: 282

European-Non Finnish (NFE) AF: 0.0601 AC: 3917 AN: 65124

Other (OTH) AF: 0.0521 AC: 99 AN: 1902

Alfa AF: 0.0535 Hom.: 292

ClinVar

Significance: Benign

Submissions summary: Benign:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:2

Feb 16, 2025

Laboratory of Genetics, Children's Clinical University Hospital Latvia

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 04, 2022

Mendelics

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

KCNN3-related disorder Benign:1

Mar 20, 2024

PreventionGenetics, part of Exact Sciences

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=75/25	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3831942; hg19: chr1-154842199; COSMIC: COSV55219110; COSMIC: COSV55219110;