rs3831942

chr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-Gchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTchr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NM_002249.6(KCNN3):c.212_241del(p.Gln71_Gln80del) variant causes a inframe deletion change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.0000015 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNN3 NM_002249.6 inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 3.39

Genes affected

KCNN3 (HGNC:6292): (potassium calcium-activated channel subfamily N member 3) Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
KCNN3	NM_002249.6	c.212_241del	p.Gln71_Gln80del	inframe_deletion	1/8	ENST00000271915.9
KCNN3	NM_001204087.2	c.212_241del	p.Gln71_Gln80del	inframe_deletion	1/9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
KCNN3	ENST00000271915.9	c.212_241del	p.Gln71_Gln80del	inframe_deletion	1/8	1	NM_002249.6	P1
KCNN3	ENST00000618040.4	c.212_241del	p.Gln71_Gln80del	inframe_deletion	1/9	5

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000147 AC: 2 AN: 1365132 Hom.: 0 AF XY: 0.00000296 AC XY: 2 AN XY: 674890

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000190

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3831942; hg19: chr1-154842199;