1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant names:

• chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCT
• rs3831942
• NM_002249.6:c.218_241dupAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Benign. The variant received -12 ACMG points: 0P and 12B. BP6_Very_Strong BS2

The NM_002249.6(KCNN3):​c.218_241dupAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln73_Gln80dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0078 (15 hom., cov: 0)
  • Exomes 𝑓: 0.0031 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNN3 NM_002249.6 conservative_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 2.12
• Publications: 18 publications found

Genes affected

KCNN3 (HGNC:6292): (potassium calcium-activated channel subfamily N member 3) Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]

KCNN3 Gene-Disease associations (from GenCC):

• Zimmermann-Laband syndrome 3

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• Zimmermann-Laband syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• schizophrenia

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000308854 (HGNC:):

ACMG classification

Our verdict: Benign. The variant received -12 ACMG points.

• BP6: Variant 1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCT is Benign according to our data. Variant chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCT is described in CliVar as Benign/Likely_benign. Clinvar id is 1685406.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCT is described in CliVar as Benign/Likely_benign. Clinvar id is 1685406.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCT is described in CliVar as Benign/Likely_benign. Clinvar id is 1685406.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCT is described in CliVar as Benign/Likely_benign. Clinvar id is 1685406.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCT is described in CliVar as Benign/Likely_benign. Clinvar id is 1685406.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAd4 at 15 Unknown,AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNN3	NM_002249.6	c.218_241dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln73_Gln80dup	conservative_inframe_insertion	Exon 1 of 8	ENST00000271915.9	NP_002240.3
KCNN3	NM_001204087.2	c.218_241dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln73_Gln80dup	conservative_inframe_insertion	Exon 1 of 9		NP_001191016.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNN3	ENST00000271915.9	c.218_241dupAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln73_Gln80dup	conservative_inframe_insertion	Exon 1 of 8	1	NM_002249.6	ENSP00000271915.3

Frequencies

GnomAD3 genomes AF: 0.00781 AC: 1104 AN: 141268 Hom.: 15 Cov.: 0

Gnomad AFR AF: 0.00753

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00545

Gnomad ASJ AF: 0.0190

Gnomad EAS AF: 0.00821

Gnomad SAS AF: 0.00593

Gnomad FIN AF: 0.00219

Gnomad MID AF: 0.0132

Gnomad NFE AF: 0.00874

Gnomad OTH AF: 0.0122

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00312 AC: 4262 AN: 1364938 Hom.: 0 Cov.: 112 AF XY: 0.00331 AC XY: 2236 AN XY: 674744

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00379 AC: 118 AN: 31102

American (AMR) AF: 0.00287 AC: 102 AN: 35510

Ashkenazi Jewish (ASJ) AF: 0.0121 AC: 301 AN: 24952

East Asian (EAS) AF: 0.0136 AC: 485 AN: 35542

South Asian (SAS) AF: 0.00503 AC: 396 AN: 78742

European-Finnish (FIN) AF: 0.00247 AC: 114 AN: 46140

Middle Eastern (MID) AF: 0.00586 AC: 26 AN: 4434

European-Non Finnish (NFE) AF: 0.00236 AC: 2477 AN: 1051722

Other (OTH) AF: 0.00428 AC: 243 AN: 56794

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00782 AC: 1105 AN: 141370 Hom.: 15 Cov.: 0 AF XY: 0.00781 AC XY: 531 AN XY: 68012

African (AFR) AF: 0.00759 AC: 287 AN: 37836

American (AMR) AF: 0.00544 AC: 77 AN: 14156

Ashkenazi Jewish (ASJ) AF: 0.0190 AC: 64 AN: 3374

East Asian (EAS) AF: 0.00824 AC: 38 AN: 4614

South Asian (SAS) AF: 0.00569 AC: 23 AN: 4042

European-Finnish (FIN) AF: 0.00219 AC: 20 AN: 9118

Middle Eastern (MID) AF: 0.0142 AC: 4 AN: 282

European-Non Finnish (NFE) AF: 0.00873 AC: 569 AN: 65176

Other (OTH) AF: 0.0121 AC: 23 AN: 1902

Alfa AF: 0.00 Hom.: 292

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:2

Feb 16, 2025

Laboratory of Genetics, Children's Clinical University Hospital Latvia

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 04, 2022

Mendelics

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

KCNN3-related disorder Benign:1

Apr 25, 2023

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=75/25	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3831942; hg19: chr1-154842199;