1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant names:

• chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCTGCT
• rs3831942
• NM_002249.6:c.215_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_002249.6(KCNN3):​c.215_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln72_Gln80dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0073 (12 hom., cov: 0)
  • Exomes 𝑓: 0.0013 (2 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNN3 NM_002249.6 conservative_inframe_insertion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 2.12

Genes affected

KCNN3 (HGNC:6292): (potassium calcium-activated channel subfamily N member 3) Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant 1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCTGCT is Benign according to our data. Variant chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCTGCT is described in ClinVar as [Benign]. Clinvar id is 1685415.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.0073 (1032/141364) while in subpopulation AFR AF= 0.0208 (787/37820). AF 95% confidence interval is 0.0196. There are 12 homozygotes in gnomad4. There are 458 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 1032 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNN3	NM_002249.6	c.215_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln72_Gln80dup	conservative_inframe_insertion	Exon 1 of 8	ENST00000271915.9	NP_002240.3
KCNN3	NM_001204087.2	c.215_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln72_Gln80dup	conservative_inframe_insertion	Exon 1 of 9		NP_001191016.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNN3	ENST00000271915.9	c.215_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln72_Gln80dup	conservative_inframe_insertion	Exon 1 of 8	1	NM_002249.6	ENSP00000271915.3
KCNN3	ENST00000618040.4	c.215_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln72_Gln80dup	conservative_inframe_insertion	Exon 1 of 9	5		ENSP00000481848.1

Frequencies

GnomAD3 genomes AF: 0.00731 AC: 1032 AN: 141262 Hom.: 12 Cov.: 0

Gnomad AFR AF: 0.0208

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00269

Gnomad ASJ AF: 0.00267

Gnomad EAS AF: 0.00497

Gnomad SAS AF: 0.00420

Gnomad FIN AF: 0.00197

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00202

Gnomad OTH AF: 0.00478

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00127 AC: 1733 AN: 1365074 Hom.: 2 Cov.: 112 AF XY: 0.00132 AC XY: 889 AN XY: 674862

Gnomad4 AFR exome AF: 0.0107

Gnomad4 AMR exome AF: 0.00138

Gnomad4 ASJ exome AF: 0.00160

Gnomad4 EAS exome AF: 0.00560

Gnomad4 SAS exome AF: 0.00246

Gnomad4 FIN exome AF: 0.00206

Gnomad4 NFE exome AF: 0.000696

Gnomad4 OTH exome AF: 0.00157

GnomAD4 genome AF: 0.00730 AC: 1032 AN: 141364 Hom.: 12 Cov.: 0 AF XY: 0.00673 AC XY: 458 AN XY: 68006

Gnomad4 AFR AF: 0.0208

Gnomad4 AMR AF: 0.00268

Gnomad4 ASJ AF: 0.00267

Gnomad4 EAS AF: 0.00499

Gnomad4 SAS AF: 0.00396

Gnomad4 FIN AF: 0.00197

Gnomad4 NFE AF: 0.00203

Gnomad4 OTH AF: 0.00473

ClinVar

Significance: Benign

Submissions summary: Benign:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

May 04, 2022

Mendelics

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Inborn genetic diseases Benign:1

Nov 03, 2022

Ambry Genetics

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3831942; hg19: chr1-154842199;