1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_002249.6(KCNN3):c.241_242insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC(p.Gln80_Pro81insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00023 (1 hom., cov: 0)
  • Exomes 𝑓: 0.000077 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNN3 NM_002249.6 inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.12

Genes affected

KCNN3 (HGNC:6292): (potassium calcium-activated channel subfamily N member 3) Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd at 32 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
KCNN3	NM_002249.6	c.241_242insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln80_Pro81insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	inframe_insertion	1/8	ENST00000271915.9
KCNN3	NM_001204087.2	c.241_242insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln80_Pro81insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	inframe_insertion	1/9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
KCNN3	ENST00000271915.9	c.241_242insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln80_Pro81insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	inframe_insertion	1/8	1	NM_002249.6	P1
KCNN3	ENST00000618040.4	c.241_242insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln80_Pro81insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	inframe_insertion	1/9	5

Frequencies

GnomAD3 genomes AF: 0.000226 AC: 32 AN: 141286 Hom.: 1 Cov.: 0

Gnomad AFR AF: 0.000345

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000216

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000276

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000769 AC: 105 AN: 1365076 Hom.: 0 Cov.: 112 AF XY: 0.0000711 AC XY: 48 AN XY: 674866

Gnomad4 AFR exome AF: 0.0000643

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000281

Gnomad4 SAS exome AF: 0.0000254

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000742

Gnomad4 OTH exome AF: 0.000229

GnomAD4 genome AF: 0.000226 AC: 32 AN: 141388 Hom.: 1 Cov.: 0 AF XY: 0.000147 AC XY: 10 AN XY: 68014

Gnomad4 AFR AF: 0.000344

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000217

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000276

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3831942; hg19: chr1-154842199;