1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_002249.6(KCNN3):c.241_242insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC(p.Gln80_Pro81insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_002249.6 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Zimmermann-Laband syndrome 3Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
- Zimmermann-Laband syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- schizophreniaInheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002249.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNN3 | NM_002249.6 | MANE Select | c.241_242insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln80_Pro81insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln | conservative_inframe_insertion | Exon 1 of 8 | NP_002240.3 | ||
| KCNN3 | NM_001204087.2 | c.241_242insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln80_Pro81insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln | conservative_inframe_insertion | Exon 1 of 9 | NP_001191016.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNN3 | ENST00000271915.9 | TSL:1 MANE Select | c.241_242insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln80_Pro81insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln | conservative_inframe_insertion | Exon 1 of 8 | ENSP00000271915.3 | ||
| KCNN3 | ENST00000618040.4 | TSL:5 | c.241_242insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln80_Pro81insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln | conservative_inframe_insertion | Exon 1 of 9 | ENSP00000481848.1 | ||
| ENSG00000308854 | ENST00000836873.1 | n.195-617_195-616insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.0000212 AC: 3AN: 141288Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000293 AC: 4AN: 1365118Hom.: 0 Cov.: 112 AF XY: 0.00000445 AC XY: 3AN XY: 674882 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000212 AC: 3AN: 141390Hom.: 0 Cov.: 0 AF XY: 0.0000441 AC XY: 3AN XY: 68016 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at