1-160115892-C-CAGGGGTCGCAGTCTAGAGGGTG

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000702.4(ATP1A2):​c.12+24_12+45dupGTCGCAGTCTAGAGGGTGAGGG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

ATP1A2
NM_000702.4 intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 1.15
Variant links:
Genes affected
ATP1A2 (HGNC:800): (ATPase Na+/K+ transporting subunit alpha 2) The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 2 subunit. Mutations in this gene result in familial basilar or hemiplegic migraines, and in a rare syndrome known as alternating hemiplegia of childhood. [provided by RefSeq, Oct 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ATP1A2NM_000702.4 linkc.12+24_12+45dupGTCGCAGTCTAGAGGGTGAGGG intron_variant Intron 1 of 22 ENST00000361216.8 NP_000693.1 P50993A0A0S2Z3W6

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ATP1A2ENST00000361216.8 linkc.12+19_12+20insAGGGGTCGCAGTCTAGAGGGTG intron_variant Intron 1 of 22 1 NM_000702.4 ENSP00000354490.3 P50993
ATP1A2ENST00000392233.7 linkc.12+19_12+20insAGGGGTCGCAGTCTAGAGGGTG intron_variant Intron 1 of 22 5 ENSP00000376066.3 B1AKY9
ATP1A2ENST00000472488.5 linkn.115+19_115+20insAGGGGTCGCAGTCTAGAGGGTG intron_variant Intron 1 of 19 2
ATP1A2ENST00000478587.1 linkn.111+19_111+20insAGGGGTCGCAGTCTAGAGGGTG intron_variant Intron 1 of 1 3

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
31
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Familial hemiplegic migraine Uncertain:1
Jul 11, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change falls in intron 1 of the ATP1A2 gene. It does not directly change the encoded amino acid sequence of the ATP1A2 protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with ATP1A2-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the effect of this variant on mRNA splicing is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr1-160085682; API