chr1-160115892-C-CAGGGGTCGCAGTCTAGAGGGTG

Position:

• chr1-160115892-C-CAGGGGTCGCAGTCTAGAGGGTG

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000702.4(ATP1A2):​c.12+24_12+45dupGTCGCAGTCTAGAGGGTGAGGG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ATP1A2 NM_000702.4 intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.15

Genes affected

ATP1A2 (HGNC:800): (ATPase Na+/K+ transporting subunit alpha 2) The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 2 subunit. Mutations in this gene result in familial basilar or hemiplegic migraines, and in a rare syndrome known as alternating hemiplegia of childhood. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATP1A2	NM_000702.4	c.12+24_12+45dupGTCGCAGTCTAGAGGGTGAGGG		intron_variant		ENST00000361216.8	NP_000693.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ATP1A2	ENST00000361216.8	c.12+19_12+20insAGGGGTCGCAGTCTAGAGGGTG		intron_variant		1	NM_000702.4	ENSP00000354490.3
ATP1A2	ENST00000392233.7	c.12+19_12+20insAGGGGTCGCAGTCTAGAGGGTG		intron_variant		5		ENSP00000376066.3
ATP1A2	ENST00000472488.5	n.115+19_115+20insAGGGGTCGCAGTCTAGAGGGTG		intron_variant		2
ATP1A2	ENST00000478587.1	n.111+19_111+20insAGGGGTCGCAGTCTAGAGGGTG		intron_variant		3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Familial hemiplegic migraine Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jul 11, 2024

This sequence change falls in intron 1 of the ATP1A2 gene. It does not directly change the encoded amino acid sequence of the ATP1A2 protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with ATP1A2-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the effect of this variant on mRNA splicing is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr1-160085682;